Сайты акцепторы: PromoPult.ru. Error 404

Содержание

определение термина, советы по выбору сайта-донора

Акцептор (от accipio — принимать) — веб-ресурс, который имеет обратные ссылки, находящиеся на сайте-доноре. Сайты-акцепторы также называют реципиентами. Понятие «акцептор» сильно устаревшее, и его использовали веб-мастера, в больших количествах закупающие ссылки на продвигаемые ресурсы.

Сегодня ввиду серьезного видоизменения линкбилдинга закупка ссылок с различных нетематических сайтов (да и вообще любых ресурсов) уже неактуальна, и SEO-специалисты смотрят в сторону обмена постами с сайтами похожей направленности, где есть целевая аудитория продвигаемого проекта. Современные веб-мастера стараются размещать ссылки на трастовых, авторитетных сайтах.

Из-за таких изменений сайты-акцепторы сегодня принято называть сайтами-партнерами, ресурсами партнеров и т. д.

SEO продвижение сайтов

Как работает связка «акцептор-донор»

В большинстве случаев сайтом-акцептором выступает недавно созданный ресурс, который необходимо продвинуть в поисковых системах. Чтобы он занял первые места в выдаче, применяются сайты-доноры, на которых размещаются статьи с обратными ссылками.

Как только новый ресурс получает необходимый ссылочный вес, он также может «перерасти» из акцептора в сайт-донор и тоже делиться ссылками на другие ресурсы. Возникает неразрывная связка, в которой работают оба типа сайтов — акцептор и донор.

Некоторые важные особенности эффективной работы такой связки:

  • Ресурс-донор с хорошим трастом максимально привлекателен для ресурса-акцептора.
  • Крайне важно получить не максимальный ссылочный вес, а максимально качественный ссылочный вес (с трастового сайта).
  • Оба типа сайтов должны быть похожи по тематике.
  • Сайт-донор должен иметь высокий показатель ТиЦ, ведь в таком случае каждая ссылка будет иметь больший вес.
  • Разумеется, чем выше у донора ТиЦ, тем дороже будет стоить размещение на нем статьи со ссылкой.
  • На одной странице донора не должно располагаться слишком много внешних ссылок на акцептор (не более 1-2).
  • Все ссылки должны быть максимально естественными, чтобы роботы поисковых систем не «заподозрили» серые методы оптимизации.
  • Если разместить слишком много ссылок на акцептор, который был создан недавно, это может привести к его пессимизации в выдаче — искусственном понижении позиций.

Как выбрать сайт-донор для продвижения акцептора

Чтобы раскрутка акцептора проходила максимально эффективно, при выборе ресурса-донора необходимо помнить про следующие важные моменты:

  • Тематика. Сайт-донор должен иметь такую же или схожую тематику, как у сайта-акцептора. Разумеется, можно использовать сайты близкие по тематике, на которых может находиться целевая аудитория акцептора (например, сайт-акцептор о моде и красоте можно продвигать путем публикации ссылок на сайте-доноре о косметике).
  • Качество сайта-донора. Чем выше уровень доверия поисковых систем к донору, тем лучше для акцептора. На этот уровень влияют разные факторы: количество посетителей, отсутствие спамных ссылок, поведенческие факторы и др.
  • Качество контента. На сайте-доноре не должны размещаться некачественные статьи с большим числом ссылок.

Что такое донор и акцептор в SEO?

– Автор: Игорь (Администратор)

В рамках данной статьи, я расскажу вам что такое донор и акцептор в SEO, а так же про связанные с этим нюансы.

Сео оптимизация это весьма непростой процесс, который требует учитывать огромное количество различных факторов. Именно поэтому, как и в любом сложном деле, всегда появляются различные термины, предназначение которых упростить процесс О двух из них, а именно о доноре и акцепторе, и пойдет речь далее.

Примечание: Так же советую ознакомиться со статьей что такое анкор и анкор-лист.

Начну с определений.

Акцептор — в общем смысле, это какой-то объект, который является принимающей стороной. В случае с сео оптимизацией речь идет о конкретной веб-странице, хотя иногда могут подразумевать сайт.

Таким образом, любой сайт и его веб-страницы являются акцептором, если речь идет о том, что на них планируют ссылаться или ссылаются с других страниц. Стоит понимать, что чаще всего под ссылками подразумевают именно внешние ссылки, то есть с других сайтов. Однако, когда речь идет о внутренней перелинковке, то подразумевают ссылки из этого же сайта.

Донор — это, собственно, веб-страница, которая ссылается на акцепторы.

Не сложно догадаться, что любая веб-страница или сайт могут быть одновременно и акцептором, и донором.

Как же взаимосвязаны эти самые доноры и акцепторы?

Исходя из определений, не каждый поймет о чем идет речь и зачем вообще нужно было вводить дополнительные термины. А дело заключается в весе сайтов и отдельных страниц. Каждая поисковая система для определения того «насколько все вокруг советуют данную веб-страницу или данный сайт» использует числовую характеристику, именуемую весом. При этом расчет этого самого параметра осуществляется по хитрым формулам.

Но и это не все, каждая страница хранит накопленный вес и постоянно его накапливает (даже если никто не ссылается на данную страницу; просто вес растет от времени). Когда вы устанавливаете ссылку, то поисковая система при анализе передает часть веса вашей страницы (но не отнимает!) той странице, на которую указывает эта самая ссылка.

Примечание: Система расчета веса — это весьма сложный вопрос, который, к сожалению, не пояснить парой строк. Поэтому это тема отдельной статьи.

Что это дает? Все очень просто, если донором выступает какой-то малоизвестный сайт, то толк от такой ссылки для акцептора весьма мал, так как вес страницы-донора соответствующий. Однако, если вес страницы донора высокий, например, ссылка от крупного портала, то толк от такой ссылки может быть весьма существенным для акцептора. Кстати, последние ссылки нередко называют жирными (так как вес большой).

Примечание: Тут стоит понимать, что жирная ссылка от крупного портала может быть эффективнее тысячи ссылок с малоизвестных сайтов.

Вот именно из-за такой катавасии с весом и были введены эти термины, так как они облегчают процесс описания.

Качество ссылок или почему это важно?

Может сложиться впечатление, что достаточно расположить ссылки где только можно и дело в шляпе. Но, это не так. Дело в том, что поисковые системы заинтересованы в том, чтобы результаты их поиска были полезными для людей. В противном случае, ими просто никто не будет пользоваться. По этой причине все ссылки так же оцениваются по качеству перед тем, как перенести с них вес.

И вот ряд вещей, которые стоит смотреть и оценивать, кроме веса

1. Схожесть тематики донора и акцептора. Простой пример. Допустим, на веб-страницу, посвященную бесплатным программам, ссылается сотня сайтов про флористику. Можно ли считать такие ссылки полезными? Если описываемые программы связаны с флористикой, то, конечно. Если же программы представляют собой, например, базы данных, то вряд ли такие ссылки можно считать полезными. Поэтому чем тематика сайта-донора ближе к тематике сайта-акцептора, тем лучше передается вес.

2. Количество внешних ссылок. Если на странице донора есть сто ссылок на другие сайты, можно ли считать такие ссылки полезными для передачи веса? Конечно, же нет. Кроме того, при расчете веса, эффект обычно уменьшается в зависимости от количества уже имеющихся ссылок. От года к году рекомендуемая цифра количества ссылок меняется. Но, обычно считается, что это где-то до 3-4 ссылок.

3. Расположение ссылки. Тут все просто, если ссылка у донора находится внутри контента (текста), то такая ссылка даст больше эффекта акцептору, чем ссылки расположенные в каких-то отдельных блоках или подвале. Ведь если автор статьи указывает ссылку, значит он сам считает ее полезной. Если же ссылка является оформлением сайта, то значит к тексту статьи она имеет меньшее отношение.

Теперь, вы знаете что такое донор и акцептор, а так же зачем они нужны в стезе сео.

☕ Хотите выразить благодарность автору? Поделитесь с друзьями!

  • Что такое битые ссылки на сайте?
  • Что такое ссылочная масса?
Добавить комментарий / отзыв

Акцептор | SEO-глоссарий | SEO-портал

Акцептор (сайт-акцептор) — сайт, на который ссылаются другие сайты (сайты-доноры). Акцептор принимает ссылочный вес и повышает свою значимость для поисковых систем за счет сайтов-доноров.

Иными словами, сайт-донор, обладающий большим весом, передает часть своего веса сайту-акцептору, продвигая его в поисковых системах.

Также эффективность продвижения сайтов таким путем зависит от качества ссылок, размещенных на сайте-доноре. Ссылки не должны выделяться в тексте и должны естественно вписываться в контент страницы, на которой они размещены. Также на странице не должно быть больше двух ссылок на сайт-акцептор. Кроме того, ссылаться донор может только на сайт с той же тематикой, что и тематика страницы, на которой размещена ссылка.

что это, как взаимодействуют, риски пессимизации, характеристики хорошего донора

Акцептор – это веб-сайт или определенная его страница, на которую ведет внешняя ссылка с другого сайта, то есть, донора.

Донор ресурса – это сайт или страница, ссылающаяся на продвигаемый ресурс и передающая ему свой ссылочный вес.

Взаимодействие акцептора и донора

Представьте, что у вас есть собственный ресурс, содержащий гиперссылку со стороннего сайта. Чтобы она выглядела естественно, а от того и передавала максимально возможный вес, для нее необходимо применить анкор, а также околоссылочный текст, соответствующий тематике страницы, на которую ведет ссылка. В данном случае ваш сайт выступает в качестве донора. Если кликнуть по ссылке, вы попадете на ресурс-акцептор, на который ссылаетесь. Но почему же специалисты назвали их именно такими терминами?

У любой интернет-страницы есть определенный ссылочный вес, увеличивающийся по мере того, как на нее начинают ссылаться другие страницы. Накапливается статический вес посредством внешних ссылок, через которые донор передает свой вес акцептору. Но если в медицине у человека-донора объем крови постепенно уменьшается, то в SEO сайт-донор не теряет вес.

Затем акцептор может передавать принявший вес другим ресурсам, выступая уже донором. Но важно отметить, что донировать тому же сайту, от которого получил вес, он не может. Поэтому любой ресурс может выступать как в качестве акцептора, так и в качестве донора.

Во всем этом механизме выгоду получает именно сайт-акцептор. Когда сторонние источники размещают на него внешние гиперссылки, ссылочный вес акцептора становится больше, что положительно влияет на его поисковое продвижение и позиции в выдаче. Однако необходимо понимать, что приоритетным является не общее количество ссылок, а их качество, то есть, параметры сайтов-доноров. Чтобы понять, насколько донорская ссылка качественная, учитываются такие критерии:

  • тематическая близость акцептора и донора;
  • возраст домена ссылающегося ресурса;
  • полезность контента, который содержится на сайте-доноре;
  • трафик на передающем вес сайте;
  • показатели тИЦ, вИЦ, PR;
  • число внешних ссылок.

На заметку. Ссылку необходимо размещать в теле статьи. В противном случае, когда ссылка находится в подвале, поисковые системы воспринимают это как один из способов манипуляции результатами выдачи, впоследствии чего могут накладывать на сайт фильтр.

Эффективнее всего на одной странице размещать только одну ссылку, тогда через нее она передаст весь свой вес.

Риск пессимизации акцептора

Если выстроить неправильную стратегию работы со ссылками, вебмастер рискует подвергнуть свой сайт попаданию под санкции. Поисковики не любят ресурсы, пытающиеся занять лидирующие позиции в результатах выдачи в основном за счет покупки ссылок.

Каждый день поисковые системы совершенствуются, пытаясь поднимать в ТОП выдачи веб-сайты, способные ответить на запросы пользователей максимально информативно, точно, интересно и полезно. Но контент многих сайтов сильно уступает «тяжести» их страниц.

И так как релевантность контента не является единственным ключевым фактором, формирующим выдачу поисковой системы, недобросовестные владельцы ресурсов больше внимания уделяют ссылочному ранжированию, покупая ссылки на специальных биржах. Но если слишком увлечься размещением искусственных ссылок, ответная реакция поисковиков не заставит ждать – сайт незамедлительно потеряет позиции в выдаче.

Наиболее распространенными основаниями для пессимизации являются:

  • стремительный рост количества внешних ссылок на сайт за небольшой период времени;
  • изобилие ссылок с некачественных ресурсов;
  • огромное количество ссылок, содержащих SEO-анкоры;
  • значительный процент ссылок с ресурсов другой тематики.

Главные характеристики хорошего донора

Алгоритмы Penguin от Google и «Минусинск» от Яндекса оштрафовали уже не одну сотню ресурсов из-за неграмотного увеличения ссылочной массы. Поэтому нужно уметь анализировать характеристики сайтов-доноров и различать, какие из них качественные, а какие – нет. Закупая обратные ссылки с хороших доноров, вам удастся избежать санкций со стороны поисковых систем.

Возраст

Если выбирать, покупать внешнюю ссылку с «зеленого» ресурса, которому чуть больше года или, например, с шестилетнего сайта, разумнее остановиться на втором варианте. Если сайт проиндексирован уже давно и продолжает пополняться новыми публикациями, то внешняя ссылка с него более ценная для поисковиков.

ИКС

Важнейший показатель от Яндекса, отражающий качество сайта. Каждые два-три месяца у всех сайтов данный параметр либо обновляется, либо остается прежним. А зависит ИКС именно от внешних ссылок, трафика, полезности ресурса.

То есть, качество обратной ссылки с донора также зависит и от качества ссылок, ведущих на него с других источников.

Трафик

Чем больше посещаемость сайта, тем ценнее он для поисковых машин.

Близость тематики и региона

Обратная ссылка выглядит максимально естественной, когда темы донора и акцептора аналогичные. Поисковики сразу заподозрят ссылку, если она будет вести с сайта, посвященного строительству, на ресурс про животных. То же самое касается и региональной привязки. Хорошо, если сайт о монтажных работах в Москве ссылается на подобный ресурс.

Качество контента

Один из ключевых критериев ранжирования. Материалы на ресурсе, передающем вес, должны быть релевантными запросам, уникальными и правильно оптимизированными. Если из-за допущения критических ошибок в оптимизации донор исключат из индекса, то внешняя ссылка с него абсолютно бесполезная.

Отличный контент разделен на подзаголовки и абзацы, содержит списки, блоки, изображения, графики, видеоролики и прочее.

Количество ссылок

Чем больше на ресурсе-доноре ссылок, ведущих на чужие сайты, тем меньше они будут передавать вес вашему веб-проекту, потому что он равномерно распределяется между всеми ссылками. Оптимальное количество ссылок на странице-доноре – 2-3 штуки. Если больше – лучше поищите другой ресурс для получения веса.

Расположение ссылки

Запомните два правила для размещения ссылки:

  1. Глубина вложения. Ссылка, расположенная ближе к поверхности, более эффективная.
  2. Нахождение непосредственно в документе. Ценнее те ссылки, которые находятся в верхней части страницы.

Их необходимо придерживаться, так как от этого зависит передача веса.

Социальная активность

Не менее важна и оживленность на сайте-доноре. Чем больше комментариев и чем они свежее, чем чаще посетители ставят лайки и репостят публикации в социальных сетях, тем лучше. Активность пользователей указывает на то, что ресурс интересный и, самое главное, актуальный. Нет смысла размещать ссылку на «мертвом» сайте.

Дизайн и архитектура

Внешний вид сайта должен быть приятным. Если присутствуют ошибки в коде донора, верстка и структура организована недобросовестно, то это явный признак того, что владельца сайта интересует только продажа и покупка ссылок.

Заключение

Сегодня оптимизаторам открыто множество способов наращивания ссылочной массы. На биржах вы найдете огромное количество доноров, у которых можно купить обратные ссылки. Но ни в коем случае не выбирайте сайты для увеличения ссылочного профиля «вслепую». Обращайте внимание на их качество.

И если вы не можете отыскать достаточное количество именно качественных доноров, то помните, что «лучше меньше, но лучше». И знайте, что не всегда ресурс, владелец которого запрашивает высокую оплату за размещение ссылки, отвечает требованиям поисковых систем.

Акцептор

Сайт-акцептор в специфике SEO-специалистов – это продвигаемый ресурс, на который ведут ссылки, находящиеся на сайте-доноре. Ресурсы акцептора и донора работают в тесной взаимосвязи и являются активными участниками процедуры продвижения интернет-проектов.

Особенности работы ресурсов-акцепторов

Непосредственная схема функционирования сайтов-акцепторов и сайтов-доноров заключается в выполнении следующих действий:

  • нахождение сайта, согласного стать донором и обладающего высокими показателями тИЦ, значительным весом и иными положительными показателями авторитетности;
  • размещение на страницах донора ссылки на акцептор, влекущее передачу части донорского веса акцептору (собственный вес донора при этом сохраняется, и обратного донирования не происходит).

Пользуясь весом своего донора, акцептор приобретает большую значимость и обретает возможность естественным путем подниматься в результатах поисковой выдачи. В дальнейшем ресурс-акцептор сможет выполнять функции сайта-донора для других веб-проектов и передавать вес сайта-донора дальше, проводя одновременно и акцептацию, и донирование.

Особенности использования ресурсов-доноров и акцепторов

Способ продвижения сайтов с помощью ссылок относится к самым популярным и эффективным механизмам работы оптимизаторов, обеспечивающим естественность осуществляемого продвижения.

Пользуясь схемой донор-акцептор, оптимизаторам следует избегать серых методов оптимизации сайта и ошибочных стратегий наращивания ссылочной массы, например, размещения слишком большого числа обратных ссылок за короткий временной промежуток или появления обратных ссылок на ресурсе-доноре, не обладающем достаточным качеством и весом.

Добавим, что подбор площадки-донора должен осуществляться особенно внимательно, с учетом необходимости присутствия сходной тематики акцептора и донора, наличия высокого траста и оптимального числа ссылок на одной странице ресурса, вписанных в текстовый контент органично и естественно.

SEO-wiki – Что такое Акцептор

SEO-wiki – Что такое Акцептор × Алфавитный указатель

Акцептор

Под акцепторами понимаются сайты, на которые ссылаются другие ресурсы в сети интернет. Важная особенность таких ресурсов состоит в том, что сайты-акцепторы, принимая «вес» других ресурсов, могут распределять его либо внутри своих страниц посредством внутренней перелинковки, либо передавать другим сайтам в интернете, кроме донора, от которого получен этот вес.

Спасибо!

Скоро мы свяжемся с Вами!

Спасибо!

Скоро мы свяжемся с Вами!

Спасибо!

Скоро мы свяжемся с Вами!

× Продолжая использовать наш сайт, вы даете согласие на обработку файлов cookie, пользовательских данных (сведения о местоположении; тип и версия ОС; тип и версия Браузера; тип устройства и разрешение его экрана; источник откуда пришел на сайт пользователь; с какого сайта или по какой рекламе; язык ОС и Браузера; какие страницы открывает и на какие кнопки нажимает пользователь; ip-адрес) в целях функционирования сайта, проведения ретаргетинга и проведения статистических исследований и обзоров. Если вы не хотите, чтобы ваши данные обрабатывались, покиньте сайт.

× Продолжая использовать наш сайт, вы даете согласие на обработку файлов cookie, пользовательских данных (сведения о местоположении; тип и версия ОС; тип и версия Браузера; тип устройства и разрешение его экрана; источник откуда пришел на сайт пользователь; с какого сайта или по какой рекламе; язык ОС и Браузера; какие страницы открывает и на какие кнопки нажимает пользователь; ip-адрес) в целях функционирования сайта, проведения ретаргетинга и проведения статистических исследований и обзоров. Если вы не хотите, чтобы ваши данные обрабатывались, покиньте сайт.

Акцептор — Словарь — Линкбилдер

Акцептор (от англ. acceptor) – термин в SEO-сфере, обозначающий страницу, веб-сайт или же документ на который ведет проставленная ссылка. В свою очередь уместно сразу же выделить такой термин, как донор – ресурс, размещающий у себя ссылку.

Взаимосвязь между акцептором и донором

Мы не случайно в статье об «акцепторе» упомянули термин «донор». Это объясняется тем, что между ними существует неразрывная связь. В целом ее, взаимосвязь, можно обрисовать довольно просто – пользователь попал на страницу некого портала, назовем его Сайт 1. Просматривая информацию, он обнаружил ссылку, кликнув по которой, перешел уже на другой ресурс, условно обозначим его Сайт 2.

Нами была описана схема связи между «донором» и «акцептором» с точки зрения обычного рядового пользователя сети Интернет. Однако она имеет и внутреннюю сторону, играющую первостепенное значение для поисковых систем (ПС).   

Как известно, каждый сайт или страница обладают определенным весом, иначе говоря, авторитетностью в глазах поисковых систем. При размещении ссылки «донор» передает свой вес «акцептору», в результате чего тот поднимает свою авторитетность в глазах ПС.

Одновременно акцептор может быть донором, а донор, в свою очередь, акцептором.

Влияние качества ссылок на акцептор

Как вы уже успели понять из вышенаписанного, акцептор повышает свой вес в «глазах» поисковых систем за счет доноров. Поэтому следует тщательно подходить к выбору площадок-доноров. Не всегда количество означает качество.

В связи с этим перечислим основные критерии, предъявляемые к донору, соответствие которым обеспечит положительное влияние на акцептор:

  • две-три ссылки на донорской странице;
  • высокая трастовость донора;
  • схожая тематичность донора и акцептора;
  • естественный, «живой» характер происхождения ссылки.

Соблюдение этих критериев обеспечит увеличение веса акцептора, а вместе с ним и улучшение его позиций в поисковой выдаче.

Заказывая продвижение своих проектов в сервисе «Линкбилдер», вы можете не беспокоиться за качество проставляемых естественных ссылок. Все они отвечают вышеперечисленным требованиям. Поэтому можно смело ожидать положительной реакции поисковых систем на новые бэк-линки, а вместе с ней и рост позиций.

Глобальная кинетика сайтов сплайсинга доноров и акцепторов в клетках человека

[Примечание редакции: ответы автора на первый раунд рецензирования приводятся ниже.]

Рецензент № 1:

[…] 1) Эта рукопись технически и биологически насыщена, с математическим моделированием и структурной интерпретацией полученных кинетических данных. Я думаю, что необходимо предоставить более подробную информацию о методах, чтобы дать читателям понимание (1) точных шагов нормализации, масштабирования и моделирования в отношении того, как интерпретировать каждое значение, используемое для этих шагов, (2) предположения о кинетических отношениях, которые лежат в основе этих моделей, и (3) как оценить уместность и валидность этой модели (как описано ниже).

Благодарим рецензента за комментарий. (1) Мы описали процедуру нормализации всплесков в основном тексте. (2) Мы предоставили более подробную информацию о нашем кинетическом моделировании в Приложении (подразделы «Обозначения, определения и отношение к сращиваемым величинам, найденным в литературе» и «Кинетические модели»). (3) Чтобы оценить уместность и достоверность нашей модели, мы сравнили нашу модель с двумя другими альтернативными, более сложными моделями сращивания (подраздел «Сравнение моделей» в Приложении).В результате наша модель (два свободных параметра, постоянная скорость) оценивает скорость синтеза, склейки и деградации более точно, чем другие модели, по крайней мере, на один порядок величины (подраздел «Оценка параметров», Приложение — рисунки 13). . Когда мы применили модель к нашим экспериментальным данным, результаты были одинаковыми для всех моделей (подраздел «Экспериментальные данные» приложения, приложение — рисунки 8-11). Чтобы оценить уместность и валидность нашей модели, мы добавили в Приложение подраздел («Качество соответствия»), в котором мы проверили качество согласованных ставок (см. Ответ ниже).

2) Я думаю, было бы очень полезно получить оценку того, насколько хорошо их модель соответствует их данным, а также ограничения этой модели (и используемых данных). В идеале это должно быть обеспечено ортогональным подходом, но я сочувствую, что эксперименты, необходимые для этого, могут быть недопустимыми с точки зрения логистики. Однако расчетная оценка этого — либо с помощью моделирования (с учетом того, насколько хорошо их модель улавливает основную истину после учета всех сделанных допущений), либо оценка соответствия их модели — имеет решающее значение.Это связано с тем, почему они выбирают кинетическую модель первого порядка, учитывая, что они, кажется, моделируют несколько потенциальных процессов первого порядка (синтез, разрыв связи и деградация РНК) одновременно.

Благодарим рецензента за содержательный комментарий. Чтобы оценить, оценивает ли наша модель кинетические скорости на основании достоверных данных, мы сгенерировали смоделированные наборы данных в предположениях кинетических моделей первого порядка, используя реалистичные диапазоны параметров, чтобы оценить, насколько точной была оценка параметров.Наши расчетные коэффициенты точно восстановили смоделированные (подраздел «Моделируемые и адаптированные коэффициенты» в Приложении, Приложение — рисунки 12-13). Сравнение ожидаемого и наблюдаемого количества доноров (Приложение — рисунок 16), акцептора (Приложение — рисунок 17), переходов (Приложение — рисунок 18) демонстрирует точность нашей модели. Кроме того, мы также оценили, насколько надежно наше соответствие отклонениям от предположения о кинетике первого порядка с помощью моделирования данных с различной кинетикой (отложенный процесс и связанные ОДУ).Это показало, что i) эти более сложные кинетические модели трудно согласовать с нашим планом эксперимента (Приложение — рисунки 1-3) и ii) ОДУ 1-го порядка могут быть надежно согласованы с такими данными, что дает параметры, которые можно интерпретировать (Приложение — рисунки). 4-11).

3) Одно предположение, которое, по-видимому, было сделано при их кинетическом моделировании, заключается в том, что сайт (донор / акцептор) был создан точно в начале мечения, в то время как экспериментальная фрагментация, присущая протоколу TT-seq, позволяет нам знать что секвенируемый сайт действительно был транскрибирован когда-то во время периода мечения, возможно, в самом начале или в самом конце этого периода.Как авторы могут это объяснить (т.е. должно ли предположение, учитывая равномерную вероятность транскрибирования в течение каждого конечного времени в периоде маркировки, состоять в том, что сайт был расшифрован в среднем в начале или середине периода маркировки)?

Нет, кинетическая модель первого порядка не предполагает, что каждая молекула создается в начале временного ряда, но что они непрерывно синтезируются и разлагаются в течение временного ряда. В связи с этим моментом наша модель не учитывала время до тех пор, пока 4sU не станет доступным для механизма транскрипции (путем распространения и импорта).Задержка — это константа, одинаковая для всех генов. Обратите внимание, что это время должно быть очень коротким, так как меченая РНК была обнаружена через 2 мин мечения. Упомянем этот момент в Приложении.

4) Авторы делают предположения о максимальной скорости элонгации полимеразы для некоторых из своих анализов, однако исследования также показали существенную вариабельность скоростей элонгации полимеразы по генам и, возможно, по регионам внутри гена. Как это может повлиять на их выводы о длине интрона, влияющей на время до сплайсинга или других наблюдений?

Мы согласны с рецензентом и знаем, что скорость элонгации Pol II зависит от гена и показывает вариабельность по регионам внутри генов.Однако точный расчет степени удлинения Pol II потребует интеграции данных TT-seq с локальным профилированием занятости Pol II, что затруднительно и само по себе оправдывает рукопись. Было показано, что скорость удлинения Pol II варьируется от 0,5 до 4 кб / мин (Gressel et al., 2017, Jonkers et al., 2014, Ardehali and Lis, 2009), при средней скорости удлинения 2,3 кб / мин (Gressel et al., 2017, Fuchs et al., 2014; Jonkers et al., 2014; Saponaro et al., 2014, Veloso et al., 2014).Pol II ускоряется в теле гена до 4 кб / мин, что указывает на более быструю транскрипцию интронов (Gressel et al., 2017, Jonkers et al., 2014). Из-за этого мы сообщили об общей тенденции, предполагающей скорость элонгации Pol II в интронах 4 кб / мин. Исследование интрон-специфической взаимосвязи скорости элонгации Pol II и сплайсинга может быть интересным направлением будущих исследований. Теперь мы прокомментируем это в Обсуждении.

5) Авторы, кажется, предполагают, что предыдущие исследования могли переоценить скорость сплайсинга и не учли смещения в этих скоростях по всему гену, однако это исследование, похоже, дает аналогичные значения скорости сплайсинга.Как они объясняют это совпадение своих измерений? Более того, как они могли бы проводить эти сравнения, учитывая, что большинство других исследований оценивали скорости, рассматривая весь интрон, а не каждый отдельный сайт сплайсинга? Кажется, что скорость образования стыков может быть лучшим показателем для сравнения, однако они не уделяют особого внимания анализу или времени на этой конкретной метрике (которая свидетельствует о завершении сращивания).

Самый близкий к нам набор данных — это набор данных Mukherjee et al., 2016, который использует 4sU-seq в клетках человека. Mukherjee et al., 2016, не вычисляли кинетику сплайсинга отдельных интронов, а только классифицировали их как быстрые, средние или медленные, путем кластеризации данных временных рядов. Поэтому мы не могли напрямую сравнивать скорость сплайсинга отдельных интронов. Mukherjee et al., 2016 предоставили скорости сплайсинга на уровне генов, которые были рассчитаны путем подбора кинетики первого порядка для полной РНК-предшественника с использованием RSEM для оценки количества зрелой и РНК-предшественницы. Чтобы сравнить наши результаты с их результатами, мы усреднили время расщепления донора и акцептора в основных изоформах, поскольку эти считывания специфичны для предшественника.В то время как наши измерения периода полураспада хорошо коррелируют между генами, показатели скорости синтеза и скорости сплайсинга были более скромными (Рисунок 2 — рисунок в приложении 1D). Порядки величин совпадают. Оценка скорости образования соединений указывает на завершение сплайсинга, но не является наиболее информативным показателем для оценки времени, необходимого для сплайсинга донорного и акцепторного сайтов сплайсинга (время расщепления). При условии идеальной урожайности. то есть каждая РНК-предшественник приводит к зрелой РНК, скорость образования соединений равна скорости синтеза предшественника.Таким образом, это примерно постоянная величина для одной расшифровки. Теперь мы объясним это в Приложении (Приложение 1 — таблица 1).

6) Я действительно не понимаю измерение выхода сращивания и, в частности, как оно отличается или сравнивается со стандартным значением процента сращивания, которое обычно используется для оценки шаблонов сращивания в наборах данных RNA-seq. Что произойдет, если взглянуть только на количество прочитанных на этих сайтах — говорят ли нам о каких-либо показателях что-то другое? Было бы полезно поместить это в контекст метрики, о которой читатели могут привыкнуть думать, чтобы дать ей правильную интерпретацию.

Приносим извинения за недостаточную ясность в тексте и благодарим рецензента, который указал на это. В Приложении мы теперь связываем нашу метрику с существующими, включая Psi. В подразделе Приложения «Обозначения, определения и отношение к количеству сращивания, встречающееся в литературе» мы добавили более подробное объяснение того, как мы определяли количество сращивания, а также разницы между процентом сращивания и выходом сращивания. Выход сплайсинга не может быть рассчитан на основе данных RNA-seq в стационарном состоянии, потому что синтез и деградация взаимосвязаны в данных в стационарном состоянии.Мы также тщательно отредактировали текст, чтобы сделать его более понятным, и надеемся, что рецензент с этим согласен.

Рецензент № 2:

В этой рукописи Wachutka et al. Авт. Используют моделирование 4sU импульсных данных секвенирования РНК, чтобы сделать вывод о скоростях сплайсинга интронов в масштабе всего генома. Затем они используют характеристики последовательности и сравнение со структурными данными, чтобы сделать выводы о скоростях переэтерификации на первом и втором этапе. Экспериментально клетки подвергаются кратковременному воздействию 4-тиоурацила, и РНК, образующаяся во время этого импульса, будет включать 4sU и может быть очищена путем удаления биотина.Таким образом, соединение (экзон-интрон, интрон-экзон, экзон-экзон), которое все еще существует в течение некоторого переменного времени преследования, предоставляет кинетическую информацию о скорости удаления этого конкретного соединения. Эти процессы удаления могут быть сплайсингом, распадом, не опосредованным смыслом, или распадом мРНК. Обычно вся РНК удаляется, давая полную историю этого конкретного транскрипта. Нововведение лаборатории Крамера (ранее опубликованный метод TT-seq) состоит в том, чтобы фрагментировать эту РНК до <6kb, что устраняет часть эффекта памяти, хотя все еще анализируется РНК, которая была транскрибирована до импульса.Настоящая работа полностью основана на анализе этого одного набора данных в ячейках K562. В целом, у меня есть глубокие опасения по поводу анализа, которые еще больше усугубляются полным отсутствием возмущений или каких-либо попыток сравнения с наземной истинной мерой кинетики сращивания. По этим причинам я не думаю, что статья подходит для eLife.

Мы благодарим рецензента за признание преимуществ TT-seq. Однако мы хотим отметить, что нет никаких оснований полагать, что мы действительно анализируем РНК, которая была транскрибирована до импульса.Перекрестное загрязнение меченых фрагментов РНК немеченой РНК отсутствует, а длина фрагмента РНК намного короче, чем расстояние, на которое протекает полимераза во время мечения. Таким образом, предположение рецензента не обосновано. Мы также считаем, что здесь может быть недоразумение: мы не проводим эксперимент с отслеживанием импульсов, а применяем маркировку импульсов различной длины. Анализ экспериментов с отслеживанием импульсов in vivo затруднен из-за рециркуляции меченого урацила после деградации РНК.У нашего подхода нет этого ограничения. Мы думаем, что это лучший доступный в настоящее время экспериментальный протокол для вывода показателей in vivo, которые тесно связаны с событиями сплайсинга. Поскольку мы также предоставляем данные об урожайности сварки и можем связать наши данные in vivo со структурными данными in vitro, мы считаем, что наша рукопись является новой, своевременной и очень подходящей для eLife . Убедительно просим рецензента пересмотреть свое мнение в свете нашего дополнительного анализа и моделирования.

1) Следующий пример иллюстрирует мою проблему с этим подходом.Возьмем, к примеру, чтение донорского соединения экзон-интрон. Предположим, что единственный способ исчезновения этой коллекции чтений — это первая стадия переэтерификации сплайсинга, что означает, что полимераза должна по крайней мере достичь точки ветвления, за которой следует нуклеофильная атака точки ветвления. Именно эта вторая часть является скоростью первого шага сращивания, а не временем достижения точки ветвления.

Мы приносим свои извинения, если не объяснили это достаточно ясно в тексте: то, что мы определяем как «время донорского расщепления», является суммой двух различных процессов, времени элонгации до точки ветвления и первого этапа переэтерификации, которые вместе определяют время, необходимое для расщепляют фосфодиэфирную связь донорного сайта сплайсинга.На самом деле мы широко использовали это в нашей рукописи, чтобы получить представление о ко-транскрипционной природе этого процесса. Из-за этого мы могли исследовать роль длины интрона и, следовательно, времени элонгации, в параграфе статьи «Длина интрона ограничивает время котранскрипционного сплайсинга», где мы прямо заявили, что кинетика сплайсинга донора регулируется временем, которое требуется полимеразе. расшифровать интрон. Чтобы избежать недоразумений, мы опишем процессы, определяющие время расщепления донорного сайта и акцепторного сайта, в первом абзаце раздела «Кинетическое моделирование».Мы также изменили название рукописи, которое могло быть слишком коротким и, следовательно, вводящим в заблуждение. Таким образом, кинетические открытия имеют отношение к пониманию сплайсинга и его котранскрипционной природы in vivo.

Кроме того, это время удлинения до точки ветвления не имеет экспоненциального распределения, потому что RNAP является процессивным ферментом. На этот раз просто нельзя моделировать одностадийную реакцию, это скорее серия многих экспоненциальных реакций.

Могут быть разработаны более сложные модели, но их необходимо будет адаптировать к данным.Мы исследовали альтернативные модели (подразделы «Кинетические модели» и «Сравнение моделей» в Приложении). Одна из них — модель задержки для моделирования времени транскрипции интрона. Другая представляет собой сопряженную модель чтения соединений, которая объединяет два экспоненциальных процесса, а именно расщепление донорного сайта / акцепторного сайта и деградацию зрелой РНК. Когда мы сравнили нашу модель с другими более сложными моделями (подраздел «Оценка параметров» в приложении), мы обнаружили, что более сложные модели обычно не имеют преимуществ перед нашей простой моделью, потому что наши экспериментальные данные слишком ограничены, чтобы существенно различать модели.На основе смоделированных данных мы показываем, что простая модель с постоянной скоростью незначительно отклоняется от результатов, если мы применяем более сложные модели, и различия обычно ниже нашей расчетной экспериментальной ошибки. Кроме того, более сложные модели менее точны для оценки, и поэтому общая точность нашего анализа снизится. Систематические ошибки между разными моделями возникают только в том случае, если мы сравниваем кинетические скорости между разными моделями, как это сделано в нашем расчете выхода сращивания.Следовательно, это единственный случай, когда мы применяем более сложные модели. В совокупности, хотя процесс ко-транскрипционного сплайсинга сложен и в идеале должен описываться с помощью более подробных моделей в будущем, экспериментальные данные ограничивают то, что можно моделировать, и наша модель является надежной и действительно отражает процесс значимым образом, что позволяет нам сделать простые выводы.

Более того, даже если бы кто-то каким-то образом включил эту информацию, имея в виду локальный контекст этого донорского соединения, а затем вычислил время удлинения до точки ветвления, невозможно было бы узнать из этого анализа, какая точка ветвления была выбрана.Это упущение является критическим и, на мой взгляд, фатальным недостатком этого анализа. Я не понимаю, как можно определить скорость для первого шага сращивания, не зная, какая точка ветвления использовалась. Идя дальше, было бы даже неуместно в этом анализе использовать аннотированные точки ветвления, потому что авторы претендуют на обнаружение всех видов неаннотированных интронов и событий сплайсинга. В самом деле, я думаю, что именно по этой комбинации причин так много лабораторий прилагают большие усилия для секвенирования и анализа точек ветвления.

Мы пояснили, что мы не оцениваем напрямую частоту отдельного этапа переэтерификации, который действительно мог бы привести к этим осложнениям. Кроме того, мы использовали прогнозы точек ветвления позже в рукописи для прогнозирования скорости на основе последовательности (рис. 4, 5), что является практическим способом продвижения вперед, поскольку карты точек ветвления все еще отсутствуют. Оказалось, что они имеют очень разумную предсказательную силу. Также мы хотели бы подчеркнуть, что многие интроны содержат несколько точек ветвления, но их расстояние от акцепторного сайта ограничено, обычно от 18 до 45 нуклеотидов от акцепторного сайта (Mercer et al., 2015). Взятые вместе, наши выводы не скомпрометированы тем фактом, что несколько точек ветвления могут вносить свой вклад.

) Следовательно, утверждения о «временах расщепления донора и акцептора» не имеют смысла в контексте сплайсинга. Возможно, авторы намереваются сообщить о «времени донорского расщепления», которое действительно является комбинированной мерой элонгации, выбора точки ветвления и первой химической стадии сплайсинга, но я не могу понять, какие биохимические знания были получены с этого времени.

Сравните наши ответы выше.В самом деле, мы намеренно сообщаем о времени донорского расщепления, поскольку считаем, что это величина, которую можно определить и напрямую измерить на основе таких общегеномных данных. Разделение его на его биохимические компоненты (удлинение, выбор точки ветвления и первый химический этап сплайсинга) потребует сильных допущений моделирования и приведет к переобучению данных. С помощью многочисленных анализов мы показываем, что эти времена действительно содержат информацию и, таким образом, значимы. Однако мы согласны с тем, что в будущем другие протоколы секвенирования могут предоставить информацию, которая позволит подбирать более сложные математические модели.Однако это явно выходит за рамки данной работы.

Есть склонность к тому, что они измеряют что-то, связанное со сплайсингом, на основе результатов на Рисунке 4B: время донорского расщепления изменяется с отклонениями от согласованной последовательности. Однако эти изменения, кажется, не согласуются с известной биохимией 5-х.

Мы обсудили наши данные со старшими коллегами, которые занимаются сваркой, и они обнаружили множество наблюдений, которые объясняют предыдущие биохимические данные.Обратите внимание, что мы также выполнили обширный анализ, подтверждающий наши выводы за пределами рисунка 4B, включая: 2C (сплайсинг днРНК медленнее, чем мРНК), 4A, C, D Рисунок 5, рисунок 6 (включая восстановление мотивов известных факторов сплайсинга) и рисунок 4 — рисунок добавка 2 (нуклеотид в физическом контакте со сплайсосомными комплексами). Мы рады обсудить любые отклонения от известной биохимии в рукописи, но нам понадобится этот рецензент, чтобы указать такие несоответствия. Утверждение о том, что изменения, похоже, не соответствуют известной биохимии, должно быть подтверждено, и нам нужно получить ссылки, чтобы проверить это, прежде чем мы сможем рассмотреть этот момент.

3) Теоретическим трактовкам в целом недостает строгости.

Мы существенно расширили описание метода, допущения при моделировании, интерпретацию модели и выполненное моделирование (Приложение). Мы думаем, что это очень улучшило рукопись. Опять же, нам потребуются более конкретные комментарии, если рецензент хочет, чтобы мы улучшили определенный аспект. Без уточнения мы не можем решить эту проблему.

— В нескольких статьях рассмотрена кинетика сплайсинга и смоделированы кинетические данные в отдельных клетках или даже в масштабе всего генома (PMID: 25271374, 22022255, 25541195), но авторы, похоже, не знают об этой работе.Хотя одна статья, которую они цитируют (Schmidt et al., 2011), указывает на важность правильного теоретического рассмотрения удлинения.

Мы подробно проанализировали эту опубликованную работу и внесли следующие изменения:

1) PMID 25271374 (Coulon et al., 2014)

Мы добавили цитату в текст. Авторы использовали двухцветную визуализацию одной молекулы РНК для оценки кинетики репортерного гена β-глобина в человеческих клетках U2OS. Они пришли к выводу, что интроны сплайсируются как до, так и после высвобождения транскрипта, хотя большинство из них сплайсируется после высвобождения транскрипта.Обратите внимание, что в представленной рукописи мы цитировали аналогичные статьи, в которых измерялись скорости сплайсинга в эндогенном человеческом гене β-глобина (Martin et al., 2013) и с меченным MS2-GFP интронным геном MINX (Schmidt et al., 2011). ) с визуализацией одиночных молекул в реальном времени.

2) PMID 22022255 (Aikten et al., 2011)

Авторы смоделировали кинетику сплайсинга репортерного гена Ribo1, содержащего один интрон, в дрожжах, используя данные RT-qPCR. Они пришли к выводу, что сплайсинг является преимущественно котранскрипционным и точечные мутации в 3´SS снижают вероятность того, что шаг I происходит котранскрипционно (своего рода обратная связь).Мы включили цитату в наш текст.

3) PMID 25541195 (Дэвис-Турак и др., 2015)

Это единственный полногеномный анализ. Авторы использовали математический анализ для изучения котранскрипционного сплайсинга. Однако они не анализируют данные мечения РНК. Их обработка удлинения относится к посттранскрипционному сплайсингу (т.е. ко времени, когда полимераза достигает сайта полиА), а не к транскрипции интрона. Более того, Davis-Turak et al. также использовал кинетику первого порядка для моделирования сплайсинга одиночных интронов по той же причине, что и мы, а именно, что более сложные модели не улучшали совпадения.Сейчас мы ссылаемся на эту работу, когда объясняем, почему нам пришлось принять кинетические модели первого порядка.

— Нет никакой меры для оценки соответствия или проверки других моделей.

В настоящее время мы предоставляем в Приложении, подраздел «Качество совпадений», диаграммы рассеяния количества считываний в сравнении с ожидаемым количеством считываний в соответствии с подборками (Приложение — рисунки 16-18). Они показывают очень хорошее совпадение (Spearman rho> 0,89 для всех временных точек, за исключением образцов RNA-seq с rho> 0.8 для донорных и акцепторных сайтов читается). Более низкая корреляция образцов РНК-seq для донорных и акцепторных сайтов может быть объяснена низкой распространенностью этих нерасщепленных считываний в стационарном состоянии. Кроме того, в вышеупомянутом подразделе Приложения представлены графики, демонстрирующие, насколько точно оцениваются параметры модели, когда достоверная информация известна (моделирование, Приложение — рисунки 12-13, rho> 0,99 для каждого параметра и модели). Мы также теперь исследовали точность подгонки кинетической модели не первого порядка к донорскому сайту (модель с задержкой).Это показало, что задержку трудно точно оценить (Приложение — рисунок 2). Кроме того, теперь мы также строим график предполагаемой скорости синтеза донора относительно акцепторного сайта. Предполагая, что во время транскрипции интрона не происходит падения полимеразы, они должны совпадать. Эти параметры оцениваются на основе различных данных (считывание донорского сайта и нерасщепленного считывания акцепторного сайта). Хотя они достаточно хорошо согласуются с кинетической моделью первого порядка (Приложение — рис. 14, rho = 0,42), согласие намного хуже при использовании модели задержки для донорного сайта (rho = 0.26, Приложение — рис. 19). В целом, эти анализы демонстрируют, что модели хорошо соответствуют данным, а простая более сложная модель этого не делает.

— Они используют модель червеобразной цепи, основанную на длине персистентности РНК, для вычисления энергии зацикливания. С помощью энергии они применяют уравнение Аррениуса, чтобы получить скорость и сравнить это значение со временем отщепления донора (рис. 3E). Однако трудно определить, есть ли в этих данных какая-либо тенденция и объясняет ли эта модель эту тенденцию.

Мы согласны с рецензентом в том, что эту тенденцию трудно читать, и мы удалили рисунок и его обсуждение из рукописи. В любом случае это было второстепенным для нашего анализа.

4) Я считаю, что часть результатов сращивания бумаги (рис. 7) является наиболее интерпретируемой из представленных результатов. И снова, однако, ничего из этого не было подтверждено какими-либо количественными измерениями, такими как цифровая капельная ПЦР.

Благодарим рецензента за положительный отзыв о выходе сварки.Однако напрямую без кинетического моделирования невозможно получить результат сращивания. Используя ПЦР, мы не можем проверить модель.

Таким образом, я рассматриваю этот анализ (с лежащей в основе параметризацией) как достаточно хороший способ объяснить «время отщепления донора» и «время расщепления акцептора», измеренные в этом анализе. И в таких показателях может быть какая-то полезность. Моя общая трудность состоит в том, что я не думаю, что эта параметризованная таким образом модель многое говорит нам о сплайсинге и транскрипции таким образом, чтобы это можно было проверить или интерпретировать в других анализах.Так что я рассматриваю эту статью как биоинформатическое упражнение, которому не хватает биохимических ограничений или биофизической проницательности.

Мы категорически не согласны с тем, что наша статья является «биоинформатическим упражнением». Как показано в различных местах рукописи, мы получаем биологическое понимание и можем объяснить структурные данные. Мы также надеемся, что пересмотренная версия убедит этого рецензента в дополнительной ценности и практической необходимости моделирования кинетики отдельных фосфодиэфирных связей, которые сами по себе являются биохимическими объектами и которые непосредственно измеряются с помощью анализа.Кроме того, мы надеемся, что сможем убедить этого рецензента в трудностях использования более сложных моделей, поскольку они страдают от плохой идентифицируемости параметров. Работа не должна отклоняться eLife на основании того, что это «упражнение». Вместо этого сообщество должно судить с течением времени, насколько полезны наши данные и выводы для продвижения в этой области. Мы любезно просим рецензента пересмотреть свое мнение и надеяться, что он / она сможет признать высокое техническое качество нашей работы, важность решаемой проблемы, успехи, достигнутые за пределами современного состояния, и последствия. за будущую работу в этой интересной сфере.

Рецензент № 3:

[…] Учитывая, что методы оптимизации, используемые для оценки синтеза / образования и расщепления / деградации сайтов сплайсинга / соединения, являются локальным алгоритмом, достаточно ли 10 случайных инициализаций, чтобы быть уверенным в достижении глобального минимума?

Как и ранее, мы использовали 10 случайных инициализаций (Eser et al., 2016). Для дальнейшей оценки качества наших данных мы теперь сравниваем моделируемые подсчеты, основанные на распределении синтеза, склейки, скорости деградации, с достоверными данными в Приложении (Приложение — рисунки 1, 12-13).Основываясь на этих результатах, наша модель оценивает достоверность кинетических скоростей с высокой точностью по сравнению с динамическим диапазоном этих параметров (Spearman rho> 0,99 для всех параметров). Более того, эти результаты эмпирически показывают, что оптимизация функции стоимости кинетической модели первого порядка не страдает от локальных минимумов. Это контрастирует с моделью задержки (Приложение — рисунок 2). Мы надеемся, что это проясняет опасения рецензентов.

Ключевым предположением для подгонки модели является включение 100% метки.Авторы должны подробно изучить, как более низкие уровни маркировки (например, 90, 50, 10%) влияют на их результаты и выводы.

Более низкий уровень включения метки приведет к более низким оценкам скорости синтеза (например, эффективность метки 90% приведет к недооценке скорости на 10%), но не повлияет на оценку периодов полураспада донорных и акцепторных связей и выхода сращивания . Мы добавили параграф в приложение (подраздел «Встраивание 4SU» в приложение), чтобы пояснить это дальше.

Некоторое сравнение и корреляция оценок скорости синтеза были выполнены отдельно для разных донорных сайтов и разных акцепторных сайтов (Рисунок 2 — рисунок в приложении 2B), но, как уже упоминалось, они также должны быть согласованы для донора и акцептора одного и того же гена; однако не показана зависимость скорости синтеза донора от скорости синтеза акцептора.

Мы благодарим рецензента за указание на это. В разделе приложения «Согласование кинетических параметров модели донора, акцептора и соединения» мы теперь показываем корреляцию между скоростью синтеза донора и акцептора одного и того же гена.Как и ожидалось, если предположить, что не происходит выпадения Pol II или терминации транскрипции перед концом интрона, мы обнаруживаем, что скорости синтеза донора и акцептора коррелируют.

Соответствие модели должно быть показано для отдельных генов с выделением различных классов: например, одиночный или мультиинтронный, высокоэкспрессированный или низкоэкспрессированный.

Индивидуальные посадки часто зашумлены и их трудно прочитать из-за больших отклонений из-за данных подсчета. Это соответствует нашим отчетам о точности индивидуальных ставок, которые относительно велики (примерно в 2 раза).Наши выводы основаны на агрегированном анализе. Более того, мы не наблюдали тенденции между этими разными классами. Поэтому мы решили не загромождать рукопись большим количеством отдельных примеров, чем на рисунке 2A.

Кинетический язык неточен и вызывает путаницу: например, «времена расщепления» следует называть «временами половинного расщепления» или, возможно, «временами половинного расщепления». Они не относятся к времени завершения или характерному времени.

«Скорость расщепления в диапазоне минут» также неточна.Похоже, они относятся к временам полураспада при расщеплении в минутном диапазоне. Более точным было бы сообщить фактические константы скорости расщепления в дополнение к временам полураспада расщепления. («Скорость» = константа скорости x численность).

Мы пересмотрели терминологию, также в ответ на рецензент 3. Теперь мы используем термины «период полураспада донорной связи», относящийся к периоду полураспада экзон-интронного нуклеотида и «периоду полураспада акцепторной связи», относится к периоду полураспада фосфодиэфирной связи интрон-экзон.Мы согласны с тем, что «константа скорости» более точна, чем «скорость». Отметим, однако, что в литературе (включая литературу по физике, например, см. Использование скорости распада) также часто используется термин скорость вместо константы скорости. Мы благодарим рецензента за указание на это, эти изменения улучшили язык.

Часть, посвященная методам однонуклеотидной модели, будет лучше, если будет дано более подробное описание. Кажется, это статистическая модель, основанная на ранее полученном времени расщепления и согласованной последовательности сайта сплайсинга, но методы мне не очень понятны.

Мы переписали этот раздел Материалов и методов, чтобы дать больше объяснений также для читателей, не разбирающихся в статистическом моделировании (регрессия Лассо).

[Примечание редакции: ответы автора на повторную рецензию приводятся ниже.]

Существенные изменения:

1) Авторы обзора не убеждены в том, что измеренные скорости распада и образования фосфодиэфирных связей можно напрямую отнести к отдельным стадиям распознавания и ферментативным скоростям.К тому времени, когда химический шаг вызывает потерю или усиление чтения соединения, происходят десятки событий, которые могут повлиять на скорость этого шага. Для 5′-сайта сплайсинга они включают начальное распознавание посредством U1, удлинение / паузу транскрипции в нижележащем интроне, распознавание точки ветвления (которое здесь невозможно измерить), множество этапов сборки сплайсосом и, наконец, катализ. Хотя эффекты мутаций сайта сплайсинга согласуются с известным взаимодействием 5′-сайта сплайсинга с помощью U1 snRNP, другие части будут взаимодействовать с этими остатками, и нет никаких доказательств того, что взаимодействие U1 является определяющим для скорости расщепления.Утверждать, что это так, очень упрощенно. Скорость потери соединения экзон-интрон будет совокупной функцией многих различных скоростей, которые, вероятно, варьируются от сайта к сайту и не измеряются. Следует отметить, что U1 не участвует в каталитических стадиях, а только в начальном распознавании. Сказать, что «мы разработали вычислительный подход, который моделирует скорость метаболизма РНК на уровне одиночных фосфодиэфирных связей», вводит в заблуждение. Авторам необходимо изучить свою интерпретацию своих данных и быть осторожными, чтобы не утверждать, что наблюдаемые ими скорости можно разбить на этапы, которые не измеряются.

Рецензенты правы. Мы согласны с тем, что скорости одиночных фосфодиэфирных связей нельзя однозначно связать с отдельными химическими реакциями. Мы не хотели этого предлагать, но очевидно, что в этом отношении возникло недопонимание. Поэтому мы тщательно пересмотрели каждое предложение, касающееся индивидуальных скоростей химических реакций, так что наши утверждения касаются только общей кинетики фосфодиэфирных связей. Кроме того, мы изменили предложение «мы разработали вычислительный подход, который моделирует скорость метаболизма РНК на уровне одиночных фосфодиэфирных связей» на «мы разработали вычислительный подход, который оценивает скорость метаболизма одиночных фосфодиэфирных связей».

2) Подраздел «Новые и альтернативные сайты сплайсинга», последний абзац: Авторы сообщили о количестве (177 322 и 164 533) нерасщепленных считываний, отображаемых на границах экзон-интрон (5 ‘сайты сплайсинга), в сумме с общим количеством предполагаемых сообщенных интронов. в параграфе выше (341 855, идентифицировано разделением на границе экзон-экзон). Это кажется неправильным, или они выкинули все примеры альтернативной склейки? Они не сообщают числа для границ интрон-экзон (3’-сайты сплайсинга), но ниже в том же абзаце они обрабатывают числа считывания, как если бы эти сайты были включены.В этом более позднем обсуждении авторы заявляют, что разделение гласит: «18% содержали неаннотированный донорский сайт, 22% — неаннотированный акцепторный сайт и еще 38% представляли новые предполагаемые сайты сплайсинга». В чем разница между неаннотированным донорным или акцепторным сайтом и новым предполагаемым сайтом сплайсинга? Кроме того, если вы стремитесь различать аннотированные и неаннотированные сайты, не имеет ли смысла начать с процента разделенных чтений, отображаемых в неаннотированные регионы, где все сайты, вероятно, не аннотированы, а затем обсудить новые, ранее не аннотированные сайты в GENCODE?

В этой части текста мы использовали «сплит-чтения» вместо «предполагаемых интронов».Мы исправили текст и благодарим рецензента за это. Кроме того, 38% соответствуют предполагаемым интронам, которые отображаются на неаннотированные донорные сайты и акцепторные сайты. Сейчас мы это ясно дали понять. Наконец, мы считаем, что начало или конец фильтрации неаннотированных областей не имеет принципиального значения в способе представления этих чисел.

3) Авторы указывают, что они подбирают модель независимо для каждой наблюдаемой ими комбинации донор-акцептор.Если да, то что вызывает различия в количестве донорных (162 134), акцепторных (177 543) и переходных (156 825) связей, которые они могут моделировать? Разве им не нужен достаточный охват считыванием по всем трем параметрам, чтобы достоверно оценить скорость синтеза / расщепления на уровне соединения? Или это включает в себя некоторые случаи альтернативных пар сайтов сплайсинга?

Приносим извинения, если мы недостаточно четко объяснили это в тексте. Чтобы измерить метаболизм одинарной связи, мы индивидуально моделируем три связи (донор, акцептор и соединение) для каждого обнаруженного интрона.Мы рассматриваем каждую связь как минимум с 100 подтверждающими чтениями в наборах данных. Следовательно, нам не нужно объединять их ограничения покрытия. Теперь мы дополнительно подчеркиваем, что эти модели не связаны с предложением «мы смоделировали стационарные скорости синтеза и деградации (или эквивалентного расщепления) каждой из трех различных фосфодиэфирных связей по отдельности» в разделе «Результаты».

4) Использование моделирования для оценки надежности подгонки модели как для кинетической модели первого порядка, так и для альтернативных моделей является полезным дополнением к статье.В основном тексте следует более подробно осветить, как это подтверждает достоверность метода. Также должна быть предоставлена ​​оценка того, как метод работает и где он не работает. Например, авторы указывают, что «надежность нашего подхода… согласуется с высокой точностью процедуры аппроксимации на смоделированных данных». Однако в некоторых случаях мощность всех моделей или экспериментальных систем недостаточна. Авторы должны включить краткое обсуждение того, в чем их модель не оправдывает ожиданий (сверхвысокие скорости, соображения длины и т. Д.).) и, таким образом, более полно проинформирует читателя о биологических интерпретациях, которые можно извлечь из данных. Моделирование часто является лучшим способом продвинуть модель и проверить эти крайние случаи.

Благодарим рецензентов за предложения. Мы включили новый параграф, который объясняет результаты этих симуляций и новые симуляции, которые мы провели в ответ на этот пункт, чтобы исследовать крайние случаи. Мы добавили новый раздел в Приложение (подраздел «Пределы модели»), в котором мы исследуем пределы нашей модели.Мы смоделировали подсчеты на основе модели постоянной скорости с учетом большого диапазона логарифмически равномерно распределенных скоростей синтеза связей (10 -5 -100 л / ячейка / мин) и периодов полураспада связи (10 -3 — 7×10 — 6 мин). Основываясь на этих данных, мы исследовали типичную нижнюю границу считываний, необходимых для всех образцов, чтобы правильно смоделировать кинетику связи (Приложение — рисунок 23). Мы обнаружили, что нижнее пороговое значение в 100 считываний (после 6 -го смоделированных данных) позволяет нам оценить кинетику с типичной ошибкой ниже 100%.Пороговое значение в 100 чтений — это то, что мы применили к реальным данным. Чтобы проверить самые короткие и самые длинные периоды полураспада связи, которые наш экспериментальный подход может зафиксировать и смоделировать, мы расслоили результаты по периодам полураспада связи. Затем мы поступили аналогичным образом со скоростью синтеза связей. В результате мы обнаружили, что большая часть наших смоделированных данных находится в диапазоне, в котором средняя относительная ошибка скорости синтеза и периода полураспада ниже 100% или 30% соответственно (Приложение — рисунки 24, 25).

5) В разделе «Длина интрона ограничивает время ко-транскрипционного сплайсинга.«Неясно, что авторы подразумевают под« ко-транскрипцией ».

Как мы определили во Введении, сплайсинг является «котранскрипционным», когда он происходит на вновь синтезированной РНК, все еще прикрепленной к аппарату РНК Pol II. Это не обязательно означает, что интроны вырезаются, как только акцепторный сайт транскрибируется. Тем не менее, результаты, описанные в этом разделе, не зависят от котранскрипционной природы сплайсинга. Поэтому мы изменили название подраздела, чтобы избежать недоразумений.

Авторы описывают, как период полураспада донорной связи увеличивается с увеличением длины интрона, предположительно указывая на то, что период полужизни донорной связи зависит от времени достижения точки ветвления и акцепторного сайта. Это означало бы, что первая стадия сплайсинга происходит вскоре после того, как акцепторный сайт расшифровывается и становится доступным.

Не обязательно. Мы интерпретируем эти наблюдения при условии, что первый этап сплайсинга происходит после (но не обязательно вскоре после) транскрибирования точки ветвления и акцепторного сайта, которые расположены близко друг к другу — обычно менее 40 нт.Мы не утверждаем, что первый шаг происходит «вскоре после того, как акцептор транскрибируется и доступен», но скорее, что расстояние между донором и точкой ветвления является ограничивающим фактором для кинетики сплайсинга только в очень длинных интронах (> 10 000 килобайт). Мы позаботились о том, чтобы это правильно поняли.

Если да, то почему период полураспада акцепторной связи такой большой? Средний период полураспада акцептора, равный 4 мин, указывает на то, что полимераза находится в среднем на расстоянии 16 килобайт к моменту, когда происходит второй этап сплайсинга.

Это может быть правдой, поскольку 16 т.п.н. не являются чрезмерно длинными для человеческого гена (средний размер 26 КБ, средний размер 66 КБ). Более того, известно, что Pol II останавливается на экзонах (Mayer, et al., 2015), и такая пауза находится в диапазоне минут, и, следовательно, полимераза может не продвинуться далеко в течение 4 минут.

Предлагают ли они, чтобы первый шаг был близок по времени ко второму шагу, с задержкой между транскрипцией точки ветвления и потерей донора? Или две химические стадии разделены 4 минутами? Это кажется маловероятным, поскольку это означает, что сборка сплайсосом до образования комплекса C происходит очень быстро по сравнению с переходом от первой ко второй каталитической стадиям.

Как упоминалось в ответах на вышеупомянутые вопросы, мы оцениваем общую частоту, но не можем распутать частоту отдельных биохимических стадий, влияющих на общую частоту. За исключением очень длинных интронов, период полураспада акцепторной связи аналогичен периоду полураспада донорной связи (рис. 3В). Следовательно, наши данные фактически предполагают (в согласии с интуицией рецензента), что сборка сплайсосом до образования комплекса C происходит медленно по сравнению с переходом от первой ко второй каталитической стадии.Теперь мы предлагаем эту интерпретацию рисунка 3B в рукописи.

Если авторы думают, что потеря донора происходит ближе ко времени второго шага — намного позже появления точки ветвления — тогда определение «котранскрипции», которое включает немедленный сплайсинг после транскрипции / доступности акцепторного сайта, не кажется держать. Все это требует более подробного объяснения.

Мы не хотим проводить подробное обсуждение котранскрипционной природы сплайсинга, потому что это потребует другого типа данных, которые могут быть связаны с зарождающейся РНК и транскрипцией Pol II.Однако мы проверили, что мы не делаем окончательных и неподтвержденных утверждений о природе котранскрипции. В настоящее время, не имея дополнительных данных, мы не хотим выходить за рамки этого и надеемся, что рецензент поймет.

6) Неясно, как расчет выхода сплайсинга может дать значение> 1, при этом средний выход сплайсинга, указанный для мРНК, равен 1,2. Означает ли это, что измеренные уровни мРНК предшественников постоянно недооцениваются? Если он не ограничен, как описано (0-1), производительность сварки трудно оценить, поскольку кажется, что одно или несколько измеренных значений неверны.

Выход рассчитывается путем независимой оценки скорости синтеза предшественника (с использованием нерасщепленных считываний) и зрелой РНК (с использованием разделенных считываний) и взятия соотношений. Из-за ошибок оценки эти отношения могут оказаться больше 1. Мы считаем, что это приемлемо, если это не влияет на наши выводы. С помощью моделирования мы обнаружили, что совокупный охват считыванием по всем образцам, а также период полураспада могут привести к смещению оценок скорости синтеза. Однако более высокий выход мРНК по сравнению с некодирующей РНК был резюмирован при стратификации с помощью этих возможных искажающих факторов.Теперь мы включили эти анализы (Приложение — рисунки 26, 27).

https://doi.org/10.7554/eLife.45056.067

Глобальная кинетика сайтов сплайсинга доноров и акцепторов в человеческих клетках

[Примечание редактора: ниже приводятся ответы автора на первый раунд экспертной оценки.]

Рецензент № 1:

[…] 1) Эта рукопись технически является и технически и биологически плотный, с математическим моделированием и структурной интерпретацией полученных кинетических данных. Я думаю, что необходимо предоставить более подробную информацию о методах, чтобы дать читателям понимание (1) точных шагов нормализации, масштабирования и моделирования в отношении того, как интерпретировать каждое значение, используемое для этих шагов, (2) предположения о кинетических отношениях, которые лежат в основе этих моделей, и (3) как оценить уместность и валидность этой модели (как описано ниже).

Благодарим рецензента за комментарий. (1) Мы описали процедуру нормализации всплесков в основном тексте. (2) Мы предоставили более подробную информацию о нашем кинетическом моделировании в Приложении (подразделы «Обозначения, определения и отношение к сращиваемым величинам, найденным в литературе» и «Кинетические модели»). (3) Чтобы оценить уместность и достоверность нашей модели, мы сравнили нашу модель с двумя другими альтернативными, более сложными моделями сращивания (подраздел «Сравнение моделей» в Приложении).В результате наша модель (два свободных параметра, постоянная скорость) оценивает скорость синтеза, склейки и деградации более точно, чем другие модели, по крайней мере, на один порядок величины (подраздел «Оценка параметров», Приложение — рисунки 13). . Когда мы применили модель к нашим экспериментальным данным, результаты были одинаковыми для всех моделей (подраздел «Экспериментальные данные» приложения, приложение — рисунки 8-11). Чтобы оценить уместность и валидность нашей модели, мы добавили в Приложение подраздел («Качество соответствия»), в котором мы проверили качество согласованных ставок (см. Ответ ниже).

2) Я думаю, было бы очень полезно иметь оценку того, насколько хорошо их модель соответствует их данным, а также ограничения этой модели (и используемых данных). В идеале это должно быть обеспечено ортогональным подходом, но я сочувствую, что эксперименты, необходимые для этого, могут быть недопустимыми с точки зрения логистики. Однако расчетная оценка этого — либо с помощью моделирования (с учетом того, насколько хорошо их модель улавливает основную истину после учета всех сделанных допущений), либо оценка соответствия их модели — имеет решающее значение.Это связано с тем, почему они выбирают кинетическую модель первого порядка, учитывая, что они, кажется, моделируют несколько потенциальных процессов первого порядка (синтез, разрыв связи и деградация РНК) одновременно.

Благодарим рецензента за содержательный комментарий. Чтобы оценить, оценивает ли наша модель кинетические скорости на основании достоверных данных, мы сгенерировали смоделированные наборы данных в предположениях кинетических моделей первого порядка, используя реалистичные диапазоны параметров, чтобы оценить, насколько точной была оценка параметров.Наши расчетные коэффициенты точно восстановили смоделированные (подраздел «Моделируемые и адаптированные коэффициенты» в Приложении, Приложение — рисунки 12-13). Сравнение ожидаемого и наблюдаемого количества доноров (Приложение — рисунок 16), акцептора (Приложение — рисунок 17), переходов (Приложение — рисунок 18) демонстрирует точность нашей модели. Кроме того, мы также оценили, насколько надежно наше соответствие отклонениям от предположения о кинетике первого порядка с помощью моделирования данных с различной кинетикой (отложенный процесс и связанные ОДУ).Это показало, что i) эти более сложные кинетические модели трудно согласовать с нашим планом эксперимента (Приложение — рисунки 1-3) и ii) ОДУ 1-го порядка могут быть надежно согласованы с такими данными, что дает параметры, которые можно интерпретировать (Приложение — рисунки). 4-11).

3) Одно предположение, которое, по-видимому, было сделано при их кинетическом моделировании, заключается в том, что сайт (донор / акцептор) был создан точно в начале мечения, в то время как экспериментальная фрагментация, присущая протоколу TT-seq, позволяет нам чтобы знать, что секвенируемый сайт действительно был транскрибирован когда-то во время периода мечения, это могло быть в самом начале или в самом конце этого периода.Как авторы могут это объяснить (т.е. должно ли предположение, учитывая равномерную вероятность транскрибирования в течение каждого конечного времени в периоде маркировки, состоять в том, что сайт был расшифрован в среднем в начале или середине периода маркировки)?

Нет, кинетическая модель первого порядка не предполагает, что каждая молекула создается в начале временного ряда, но что они непрерывно синтезируются и деградируют в течение временного ряда. В связи с этим моментом наша модель не учитывала время до тех пор, пока 4sU не станет доступным для механизма транскрипции (путем распространения и импорта).Задержка — это константа, одинаковая для всех генов. Обратите внимание, что это время должно быть очень коротким, так как меченая РНК была обнаружена через 2 мин мечения. Упомянем этот момент в Приложении.

4) Авторы делают предположения о максимальной скорости элонгации полимеразы для некоторых из своих анализов, однако исследования также показали существенную вариабельность скорости элонгации полимеразы по генам и, возможно, по регионам внутри гена. Как это может повлиять на их выводы о длине интрона, влияющей на время до сплайсинга или других наблюдений?

Мы согласны с рецензентом и знаем, что скорость элонгации Pol II зависит от гена и показывает вариабельность по регионам внутри генов.Однако точный расчет степени удлинения Pol II потребует интеграции данных TT-seq с локальным профилированием занятости Pol II, что затруднительно и само по себе оправдывает рукопись. Было показано, что скорость удлинения Pol II варьируется от 0,5 до 4 кб / мин (Gressel et al., 2017, Jonkers et al., 2014, Ardehali and Lis, 2009), при средней скорости удлинения 2,3 кб / мин (Gressel et al., 2017, Fuchs et al., 2014; Jonkers et al., 2014; Saponaro et al., 2014, Veloso et al., 2014).Pol II ускоряется в теле гена до 4 кб / мин, что указывает на более быструю транскрипцию интронов (Gressel et al., 2017, Jonkers et al., 2014). Из-за этого мы сообщили об общей тенденции, предполагающей скорость элонгации Pol II в интронах 4 кб / мин. Исследование интрон-специфической взаимосвязи скорости элонгации Pol II и сплайсинга может быть интересным направлением будущих исследований. Теперь мы прокомментируем это в Обсуждении.

5) Похоже, что авторы предполагают, что предыдущие исследования могли переоценить скорость сплайсинга и не учли систематические ошибки в этих скоростях по всему гену, однако в этом исследовании, похоже, получены аналогичные значения скорости сплайсинга.Как они объясняют это совпадение своих измерений? Более того, как они могли бы проводить эти сравнения, учитывая, что большинство других исследований оценивали скорости, рассматривая весь интрон, а не каждый отдельный сайт сплайсинга? Кажется, что скорость образования стыков может быть лучшим показателем для сравнения, однако они не уделяют особого внимания анализу или времени на этой конкретной метрике (которая свидетельствует о завершении сращивания).

Самый близкий к нам набор данных — это набор данных Mukherjee et al., 2016, который использует 4sU-seq в клетках человека. Mukherjee et al., 2016, не вычисляли кинетику сплайсинга отдельных интронов, а только классифицировали их как быстрые, средние или медленные, путем кластеризации данных временных рядов. Поэтому мы не могли напрямую сравнивать скорость сплайсинга отдельных интронов. Mukherjee et al., 2016 предоставили скорости сплайсинга на уровне генов, которые были рассчитаны путем подбора кинетики первого порядка для полной РНК-предшественника с использованием RSEM для оценки количества зрелой и РНК-предшественницы. Чтобы сравнить наши результаты с их результатами, мы усреднили время расщепления донора и акцептора в основных изоформах, поскольку эти считывания специфичны для предшественника.В то время как наши измерения периода полураспада хорошо коррелируют между генами, показатели скорости синтеза и скорости сплайсинга были более скромными (Рисунок 2 — рисунок в приложении 1D). Порядки величин совпадают. Оценка скорости образования соединений указывает на завершение сплайсинга, но не является наиболее информативным показателем для оценки времени, необходимого для сплайсинга донорного и акцепторного сайтов сплайсинга (время расщепления). При условии идеальной урожайности. то есть каждая РНК-предшественник приводит к зрелой РНК, скорость образования соединений равна скорости синтеза предшественника.Таким образом, это примерно постоянная величина для одной расшифровки. Теперь мы объясним это в Приложении (Приложение 1 — таблица 1).

6) Я действительно не понимаю измерение выхода сращивания и, в частности, как оно отличается или сравнивается со стандартным значением процента сращивания, которое обычно используется для оценки шаблонов сращивания в наборах данных RNA-seq. Что произойдет, если взглянуть только на количество прочитанных на этих сайтах — говорят ли нам о каких-либо показателях что-то другое? Было бы полезно поместить это в контекст метрики, о которой читатели могут привыкнуть думать, чтобы дать ей правильную интерпретацию.

Приносим извинения за недостаточную ясность в тексте и благодарим рецензента, который указал на это. В Приложении мы теперь связываем нашу метрику с существующими, включая Psi. В подразделе Приложения «Обозначения, определения и отношение к количеству сращивания, встречающееся в литературе» мы добавили более подробное объяснение того, как мы определяли количество сращивания, а также разницы между процентом сращивания и выходом сращивания. Выход сплайсинга не может быть рассчитан на основе данных RNA-seq в стационарном состоянии, потому что синтез и деградация взаимосвязаны в данных в стационарном состоянии.Мы также тщательно отредактировали текст, чтобы сделать его более понятным, и надеемся, что рецензент с этим согласен.

Рецензент № 2:

В этой рукописи Wachutka et al. Авторы используют моделирование данных последовательного РНК-секвенирования 4sU для определения скорости сплайсинга интронов в масштабе всего генома. Затем они используют характеристики последовательности и сравнение со структурными данными, чтобы сделать выводы о скоростях переэтерификации на первом и втором этапе. Экспериментально клетки подвергаются кратковременному воздействию 4-тиоурацила, и РНК, образующаяся во время этого импульса, будет включать 4sU и может быть очищена путем удаления биотина.Таким образом, соединение (экзон-интрон, интрон-экзон, экзон-экзон), которое все еще существует в течение некоторого переменного времени преследования, предоставляет кинетическую информацию о скорости удаления этого конкретного соединения. Эти процессы удаления могут быть сплайсингом, распадом, не опосредованным смыслом, или распадом мРНК. Обычно вся РНК удаляется, давая полную историю этого конкретного транскрипта. Нововведение лаборатории Крамера (ранее опубликованный метод TT-seq) состоит в том, чтобы фрагментировать эту РНК до <6kb, что устраняет часть эффекта памяти, хотя все еще анализируется РНК, которая была транскрибирована до импульса.Настоящая работа полностью основана на анализе этого одного набора данных в ячейках K562. В целом, у меня есть глубокие опасения по поводу анализа, которые еще больше усугубляются полным отсутствием возмущений или каких-либо попыток сравнения с наземной истинной мерой кинетики сращивания. По этим причинам я не думаю, что статья подходит для eLife.

Мы благодарим рецензента за признание преимуществ TT-seq. Однако мы хотим отметить, что нет никаких оснований полагать, что мы действительно анализируем РНК, которая была транскрибирована до импульса.Перекрестное загрязнение меченых фрагментов РНК немеченой РНК отсутствует, а длина фрагмента РНК намного короче, чем расстояние, на которое протекает полимераза во время мечения. Таким образом, предположение рецензента не обосновано. Мы также считаем, что здесь может быть недоразумение: мы не проводим эксперимент с отслеживанием импульсов, а применяем маркировку импульсов различной длины. Анализ экспериментов с отслеживанием импульсов in vivo затруднен из-за рециркуляции меченого урацила после деградации РНК.У нашего подхода нет этого ограничения. Мы думаем, что это лучший доступный в настоящее время экспериментальный протокол для вывода показателей in vivo, которые тесно связаны с событиями сплайсинга. Поскольку мы также предоставляем данные об урожайности сплайсинга и можем связать наши данные in vivo со структурными данными in vitro, мы считаем, что наша рукопись является новой, своевременной и очень подходящей для eLife . Убедительно просим рецензента пересмотреть свое мнение в свете нашего дополнительного анализа и моделирования.

1) Следующий пример иллюстрирует мою проблему с этим подходом.Возьмем, к примеру, чтение донорского соединения экзон-интрон. Предположим, что единственный способ исчезновения этой коллекции чтений — это первая стадия переэтерификации сплайсинга, что означает, что полимераза должна по крайней мере достичь точки ветвления, за которой следует нуклеофильная атака точки ветвления. Именно эта вторая часть является скоростью первого шага сращивания, а не временем достижения точки ветвления.

Приносим свои извинения, если мы не объяснили это достаточно ясно в тексте: то, что мы определяем как «время донорского расщепления», представляет собой сумму двух различных процессов, времени элонгации до точки ветвления и первого этапа переэтерификации, которые вместе определяют время необходимо для расщепления фосфодиэфирной связи донорного сайта сплайсинга.На самом деле мы широко использовали это в нашей рукописи, чтобы получить представление о ко-транскрипционной природе этого процесса. Из-за этого мы могли исследовать роль длины интрона и, следовательно, времени элонгации, в параграфе статьи «Длина интрона ограничивает время котранскрипционного сплайсинга», где мы прямо заявили, что кинетика сплайсинга донора регулируется временем, которое требуется полимеразе. расшифровать интрон. Чтобы избежать недоразумений, мы опишем процессы, определяющие время расщепления донорного сайта и акцепторного сайта, в первом абзаце раздела «Кинетическое моделирование».Мы также изменили название рукописи, которое могло быть слишком коротким и, следовательно, вводящим в заблуждение. Таким образом, кинетические открытия имеют отношение к пониманию сплайсинга и его котранскрипционной природы in vivo.

Кроме того, это время удлинения до точки ветвления не имеет экспоненциального распределения, поскольку RNAP является процессивным ферментом. На этот раз просто нельзя моделировать одностадийную реакцию, это скорее серия многих экспоненциальных реакций.

Могут быть разработаны более сложные модели, но их необходимо будет адаптировать к данным.Мы исследовали альтернативные модели (подразделы «Кинетические модели» и «Сравнение моделей» в Приложении). Одна из них — модель задержки для моделирования времени транскрипции интрона. Другая представляет собой сопряженную модель чтения соединений, которая объединяет два экспоненциальных процесса, а именно расщепление донорного сайта / акцепторного сайта и деградацию зрелой РНК. Когда мы сравнили нашу модель с другими более сложными моделями (подраздел «Оценка параметров» в приложении), мы обнаружили, что более сложные модели обычно не имеют преимуществ перед нашей простой моделью, потому что наши экспериментальные данные слишком ограничены, чтобы существенно различать модели.На основе смоделированных данных мы показываем, что простая модель с постоянной скоростью незначительно отклоняется от результатов, если мы применяем более сложные модели, и различия обычно ниже нашей расчетной экспериментальной ошибки. Кроме того, более сложные модели менее точны для оценки, и поэтому общая точность нашего анализа снизится. Систематические ошибки между разными моделями возникают только в том случае, если мы сравниваем кинетические скорости между разными моделями, как это сделано в нашем расчете выхода сращивания.Следовательно, это единственный случай, когда мы применяем более сложные модели. В совокупности, хотя процесс ко-транскрипционного сплайсинга сложен и в идеале должен описываться с помощью более подробных моделей в будущем, экспериментальные данные ограничивают то, что можно моделировать, и наша модель является надежной и действительно отражает процесс значимым образом, что позволяет нам сделать простые выводы.

Более того, даже если бы кто-то каким-то образом включил эту информацию, имея в виду локальный контекст этого донорного соединения, а затем вычислил время элонгации до точки ветвления, невозможно узнать из этого анализа, какая точка ветвления была выбрана.Это упущение является критическим и, на мой взгляд, фатальным недостатком этого анализа. Я не понимаю, как можно определить скорость для первого шага сращивания, не зная, какая точка ветвления использовалась. Идя дальше, было бы даже неуместно в этом анализе использовать аннотированные точки ветвления, потому что авторы претендуют на обнаружение всех видов неаннотированных интронов и событий сплайсинга. В самом деле, я думаю, что именно по этой комбинации причин так много лабораторий прилагают большие усилия для секвенирования и анализа точек ветвления.

Теперь мы пояснили, что мы не оцениваем напрямую скорость индивидуальной стадии переэтерификации, которая действительно могла бы привести к этим осложнениям. Кроме того, мы использовали прогнозы точек ветвления позже в рукописи для прогнозирования скорости на основе последовательности (рис. 4, 5), что является практическим способом продвижения вперед, поскольку карты точек ветвления все еще отсутствуют. Оказалось, что они имеют очень разумную предсказательную силу. Также мы хотели бы подчеркнуть, что многие интроны содержат несколько точек ветвления, но их расстояние от акцепторного сайта ограничено, обычно от 18 до 45 нуклеотидов от акцепторного сайта (Mercer et al., 2015). Взятые вместе, наши выводы не скомпрометированы тем фактом, что несколько точек ветвления могут вносить свой вклад.

) Следовательно, утверждения о «временах расщепления донора и акцептора» не имеют смысла в контексте сплайсинга. Возможно, авторы намереваются сообщить о «времени донорского расщепления», которое действительно является комбинированной мерой элонгации, выбора точки ветвления и первой химической стадии сплайсинга, но я не могу понять, какие биохимические знания были получены с этого времени.

Сравните наши ответы выше.В самом деле, мы намеренно сообщаем о времени донорского расщепления, поскольку считаем, что это величина, которую можно определить и напрямую измерить на основе таких общегеномных данных. Разделение его на его биохимические компоненты (удлинение, выбор точки ветвления и первый химический этап сплайсинга) потребует сильных допущений моделирования и приведет к переобучению данных. С помощью многочисленных анализов мы показываем, что эти времена действительно содержат информацию и, таким образом, значимы. Однако мы согласны с тем, что в будущем другие протоколы секвенирования могут предоставить информацию, которая позволит подбирать более сложные математические модели.Однако это явно выходит за рамки данной работы.

Есть склонность к тому, что они измеряют что-то, относящееся к сплайсингу, на основе результатов на Рисунке 4B: время донорского расщепления варьируется в зависимости от отклонений от согласованной последовательности. Однако эти изменения, кажется, не согласуются с известной биохимией 5-х.

Мы обсудили наши данные со старшими коллегами, работающими в области сплайсинга, и они обнаружили множество наблюдений, которые объясняют предыдущие биохимические данные.Обратите внимание, что мы также выполнили обширный анализ, подтверждающий наши выводы за пределами рисунка 4B, включая: 2C (сплайсинг днРНК медленнее, чем мРНК), 4A, C, D Рисунок 5, рисунок 6 (включая восстановление мотивов известных факторов сплайсинга) и рисунок 4 — рисунок добавка 2 (нуклеотид в физическом контакте со сплайсосомными комплексами). Мы рады обсудить любые отклонения от известной биохимии в рукописи, но нам понадобится этот рецензент, чтобы указать такие несоответствия. Утверждение о том, что изменения, похоже, не соответствуют известной биохимии, должно быть подтверждено, и нам нужно получить ссылки, чтобы проверить это, прежде чем мы сможем рассмотреть этот момент.

3) Теоретические подходы в целом недостаточно строгие.

Мы существенно расширили описание метода, допущения при моделировании, интерпретацию модели и выполненное моделирование (Приложение). Мы думаем, что это очень улучшило рукопись. Опять же, нам потребуются более конкретные комментарии, если рецензент хочет, чтобы мы улучшили определенный аспект. Без уточнения мы не можем решить эту проблему.

— В нескольких статьях рассмотрена кинетика сплайсинга и смоделированы кинетические данные в отдельных клетках или даже в масштабе всего генома (PMID: 25271374, 22022255, 25541195), но авторы, похоже, не знают об этой работе.Хотя одна статья, которую они цитируют (Schmidt et al., 2011), указывает на важность правильного теоретического рассмотрения удлинения.

Мы подробно проанализировали эту опубликованную работу и внесли следующие изменения:

1) PMID 25271374 (Coulon et al., 2014)

Мы добавили ссылку в текст. Авторы использовали двухцветную визуализацию одной молекулы РНК для оценки кинетики репортерного гена β-глобина в человеческих клетках U2OS. Они пришли к выводу, что интроны сплайсируются как до, так и после высвобождения транскрипта, хотя большинство из них сплайсируется после высвобождения транскрипта.Обратите внимание, что в представленной рукописи мы цитировали аналогичные статьи, в которых измерялись скорости сплайсинга в эндогенном человеческом гене β-глобина (Martin et al., 2013) и с меченным MS2-GFP интронным геном MINX (Schmidt et al., 2011). ) с визуализацией одиночных молекул в реальном времени.

2) PMID 22022255 (Aikten et al., 2011)

Авторы смоделировали кинетику сплайсинга репортерного гена Ribo1, содержащего один интрон, в дрожжах, используя данные RT-qPCR. Они пришли к выводу, что сплайсинг является преимущественно котранскрипционным и точечные мутации в 3´SS снижают вероятность того, что шаг I происходит котранскрипционно (своего рода обратная связь).Мы включили цитату в наш текст.

3) PMID 25541195 (Davis-Turak et al., 2015)

Это единственный полногеномный анализ. Авторы использовали математический анализ для изучения котранскрипционного сплайсинга. Однако они не анализируют данные мечения РНК. Их обработка удлинения относится к посттранскрипционному сплайсингу (т.е. ко времени, когда полимераза достигает сайта полиА), а не к транскрипции интрона. Более того, Davis-Turak et al. также использовал кинетику первого порядка для моделирования сплайсинга одиночных интронов по той же причине, что и мы, а именно, что более сложные модели не улучшали совпадения.Сейчас мы ссылаемся на эту работу, когда объясняем, почему нам пришлось принять кинетические модели первого порядка.

— Нет никакой меры для оценки соответствия или проверки других моделей.

В настоящее время мы предоставляем в Приложении, подраздел «Качество совпадений», диаграммы рассеяния количества считываний по сравнению с ожидаемым количеством считываний в соответствии с подборками (Приложение — рисунки 16-18). Они показывают очень хорошее совпадение (Spearman rho> 0,89 для всех временных точек, за исключением образцов RNA-seq с rho> 0.8 для донорных и акцепторных сайтов читается). Более низкая корреляция образцов РНК-seq для донорных и акцепторных сайтов может быть объяснена низкой распространенностью этих нерасщепленных считываний в стационарном состоянии. Кроме того, в вышеупомянутом подразделе Приложения представлены графики, демонстрирующие, насколько точно оцениваются параметры модели, когда достоверная информация известна (моделирование, Приложение — рисунки 12-13, rho> 0,99 для каждого параметра и модели). Мы также теперь исследовали точность подгонки кинетической модели не первого порядка к донорскому сайту (модель с задержкой).Это показало, что задержку трудно точно оценить (Приложение — рисунок 2). Кроме того, теперь мы также строим график предполагаемой скорости синтеза донора относительно акцепторного сайта. Предполагая, что во время транскрипции интрона не происходит падения полимеразы, они должны совпадать. Эти параметры оцениваются на основе различных данных (считывание донорского сайта и нерасщепленного считывания акцепторного сайта). Хотя они достаточно хорошо согласуются с кинетической моделью первого порядка (Приложение — рис. 14, rho = 0,42), согласие намного хуже при использовании модели задержки для донорного сайта (rho = 0.26, Приложение — рис. 19). В целом, эти анализы демонстрируют, что модели хорошо соответствуют данным, а простая более сложная модель этого не делает.

— Они используют модель червеобразной цепочки, основанную на длине персистентности РНК, для вычисления энергии зацикливания. С помощью энергии они применяют уравнение Аррениуса, чтобы получить скорость и сравнить это значение со временем отщепления донора (рис. 3E). Однако трудно определить, есть ли в этих данных какая-либо тенденция и объясняет ли эта модель эту тенденцию.

Мы согласны с рецензентом в том, что эту тенденцию трудно прочесть, и мы удалили рисунок и его обсуждение из рукописи. В любом случае это было второстепенным для нашего анализа.

4) Я обнаружил, что часть результатов сращивания бумаги (рис. 7) является наиболее интерпретируемой из представленных результатов. И снова, однако, ничего из этого не было подтверждено какими-либо количественными измерениями, такими как цифровая капельная ПЦР.

Мы благодарим рецензента за положительный отзыв о производительности сварки.Однако напрямую без кинетического моделирования невозможно получить результат сращивания. Используя ПЦР, мы не можем проверить модель.

Таким образом, я рассматриваю этот анализ (с базовой параметризацией) как достаточно хороший способ объяснить «время расщепления донора» и «время расщепления акцептора», измеренные в этом анализе. И в таких показателях может быть какая-то полезность. Моя общая трудность состоит в том, что я не думаю, что эта параметризованная таким образом модель многое говорит нам о сплайсинге и транскрипции таким образом, чтобы это можно было проверить или интерпретировать в других анализах.Так что я рассматриваю эту статью как биоинформатическое упражнение, которому не хватает биохимических ограничений или биофизической проницательности.

Мы категорически не согласны с тем, что наша статья является «биоинформатическим упражнением». Как показано в различных местах рукописи, мы получаем биологическое понимание и можем объяснить структурные данные. Мы также надеемся, что пересмотренная версия убедит этого рецензента в дополнительной ценности и практической необходимости моделирования кинетики отдельных фосфодиэфирных связей, которые сами по себе являются биохимическими объектами и которые непосредственно измеряются с помощью анализа.Кроме того, мы надеемся, что сможем убедить этого рецензента в трудностях использования более сложных моделей, поскольку они страдают от плохой идентифицируемости параметров. Работа не должна быть отклонена службой eLife на основании того, что это «упражнение». Вместо этого сообщество должно судить с течением времени, насколько полезны наши данные и выводы для продвижения в этой области. Мы любезно просим рецензента пересмотреть свое мнение и надеяться, что он / она сможет признать высокое техническое качество нашей работы, важность решаемой проблемы, успехи, достигнутые за пределами современного состояния, и последствия. за будущую работу в этой интересной сфере.

Reviewer # 3:

[…] Учитывая, что методы оптимизации, используемые для оценки синтеза / образования и расщепления / деградации сайтов сплайсинга / соединения, являются локальным алгоритмом, достаточно 10 случайных инициализаций, чтобы быть уверенным, что глобальный минимум был достигнут?

Как и ранее, мы использовали 10 случайных инициализаций (Eser et al., 2016). Для дальнейшей оценки качества наших данных мы теперь сравниваем моделируемые подсчеты, основанные на распределении синтеза, склейки, скорости деградации, с достоверными данными в Приложении (Приложение — рисунки 1, 12-13).Основываясь на этих результатах, наша модель оценивает достоверность кинетических скоростей с высокой точностью по сравнению с динамическим диапазоном этих параметров (Spearman rho> 0,99 для всех параметров). Более того, эти результаты эмпирически показывают, что оптимизация функции стоимости кинетической модели первого порядка не страдает от локальных минимумов. Это контрастирует с моделью задержки (Приложение — рисунок 2). Мы надеемся, что это проясняет опасения рецензентов.

Ключевым предположением для подгонки модели является включение 100% метки.Авторы должны подробно изучить, как более низкие уровни маркировки (например, 90, 50, 10%) влияют на их результаты и выводы.

Более низкий уровень включения метки приведет к более низким оценкам скорости синтеза (например, эффективность метки 90% приведет к 10% недооценке скорости), но не повлияет на оценку периодов полураспада донорных и акцепторных связей и выход сращивания. Мы добавили параграф в приложение (подраздел «Встраивание 4SU» в приложение), чтобы пояснить это дальше.

Некоторое сравнение и корреляция оценок скорости синтеза были выполнены отдельно для разных донорных сайтов и разных акцепторных сайтов (Рисунок 2 — рисунок в приложении 2B), но, как уже упоминалось, они также должны быть согласованы для донора и акцептора одного и того же гена; однако не показана зависимость скорости синтеза донора от скорости синтеза акцептора.

Мы благодарим рецензента за указание на это. В разделе приложения «Согласование кинетических параметров модели донора, акцептора и соединения» мы теперь показываем корреляцию между скоростью синтеза донора и акцептора одного и того же гена.Как и ожидалось, если предположить, что не происходит выпадения Pol II или терминации транскрипции перед концом интрона, мы обнаруживаем, что скорости синтеза донора и акцептора коррелируют.

Соответствие модели должно быть показано для отдельных генов с выделением различных классов: например, одиночный или мультиинтронный, высокоэкспрессированный или низкоэкспрессированный.

Отдельные посадки часто зашумлены, и их трудно прочитать из-за больших отклонений из-за данных подсчета. Это соответствует нашим отчетам о точности индивидуальных ставок, которые относительно велики (примерно в 2 раза).Наши выводы основаны на агрегированном анализе. Более того, мы не наблюдали тенденции между этими разными классами. Поэтому мы решили не загромождать рукопись большим количеством отдельных примеров, чем на рисунке 2A.

Кинетический язык неточен и вызывает путаницу: например, «времена расщепления» следует называть «временами половинного расщепления» или, возможно, «временами половинного расщепления». Они не относятся к времени завершения или характерному времени.

«Скорость расщепления в диапазоне минут» также неточна.Похоже, они относятся к временам полураспада при расщеплении в минутном диапазоне. Более точным было бы сообщить фактические константы скорости расщепления в дополнение к временам полураспада расщепления. («Скорость» = константа скорости x численность).

Мы пересмотрели терминологию, также в ответ на рецензент 3. Теперь мы используем термины «период полураспада донорной связи», относящийся к периоду полураспада экзон-интронной нуклеотидной связи и «полужизни акцепторной связи». ‘, имея в виду период полураспада фосфодиэфирной связи интрон-экзон.Мы согласны с тем, что «константа скорости» более точна, чем «скорость». Отметим, однако, что в литературе (включая литературу по физике, например, см. Использование скорости распада) также часто используется термин скорость вместо константы скорости. Мы благодарим рецензента за указание на это, эти изменения улучшили язык.

Часть методов однонуклеотидной модели выиграла бы от более подробного описания. Кажется, это статистическая модель, основанная на ранее полученном времени расщепления и согласованной последовательности сайта сплайсинга, но методы мне не очень понятны.

Мы переписали этот раздел Материалов и методов, чтобы дать больше пояснений также для читателей, не разбирающихся в статистическом моделировании (регрессия Лассо).

[Примечание редактора: ответы автора на повторную рецензию приводятся ниже.]

Существенные исправления:

1) Рецензенты не убеждены в том, что измеренные скорости распада и образования фосфодиэфирных связей можно напрямую отнести к отдельным этапам распознавания и ферментативные скорости. К тому времени, когда химический шаг вызывает потерю или усиление чтения соединения, происходят десятки событий, которые могут повлиять на скорость этого шага.Для 5′-сайта сплайсинга они включают начальное распознавание посредством U1, удлинение / паузу транскрипции в нижележащем интроне, распознавание точки ветвления (которое здесь невозможно измерить), множество этапов сборки сплайсосом и, наконец, катализ. Хотя эффекты мутаций сайта сплайсинга согласуются с известным взаимодействием 5′-сайта сплайсинга с помощью U1 snRNP, другие части будут взаимодействовать с этими остатками, и нет никаких доказательств того, что взаимодействие U1 является определяющим для скорости расщепления. Утверждать, что это так, очень упрощенно.Скорость потери соединения экзон-интрон будет совокупной функцией многих различных скоростей, которые, вероятно, варьируются от сайта к сайту и не измеряются. Следует отметить, что U1 не участвует в каталитических стадиях, а только в начальном распознавании. Сказать, что «мы разработали вычислительный подход, который моделирует скорость метаболизма РНК на уровне одиночных фосфодиэфирных связей», вводит в заблуждение. Авторам необходимо изучить свою интерпретацию своих данных и быть осторожными, чтобы не утверждать, что наблюдаемые ими скорости можно разбить на этапы, которые не измеряются.

Рецензенты правы. Мы согласны с тем, что скорости одиночных фосфодиэфирных связей нельзя однозначно связать с отдельными химическими реакциями. Мы не хотели этого предлагать, но очевидно, что в этом отношении возникло недопонимание. Поэтому мы тщательно пересмотрели каждое предложение, касающееся индивидуальных скоростей химических реакций, так что наши утверждения касаются только общей кинетики фосфодиэфирных связей. Кроме того, мы изменили предложение «мы разработали вычислительный подход, который моделирует скорость метаболизма РНК на уровне одиночных фосфодиэфирных связей» на «мы разработали вычислительный подход, который оценивает скорость метаболизма одиночных фосфодиэфирных связей».

2) Подраздел «Новые и альтернативные сайты сплайсинга», последний абзац: Авторы сообщили о количестве (177 322 и 164 533) нерасщепленных считываний, отображаемых на границах экзон-интрон (5 ‘сайты сплайсинга), в сумме к общему количеству предполагаемых интроны, указанные в параграфе выше (341 855, идентифицированных путем расщепления прочтения на границе экзон-экзон). Это кажется неправильным, или они выкинули все примеры альтернативной склейки? Они не сообщают числа для границ интрон-экзон (3’-сайты сплайсинга), но ниже в том же абзаце они обрабатывают числа считывания, как если бы эти сайты были включены.В этом более позднем обсуждении авторы заявляют, что разделение гласит: «18% содержали неаннотированный донорский сайт, 22% — неаннотированный акцепторный сайт и еще 38% представляли новые предполагаемые сайты сплайсинга». В чем разница между неаннотированным донорным или акцепторным сайтом и новым предполагаемым сайтом сплайсинга? Кроме того, если вы стремитесь различать аннотированные и неаннотированные сайты, не имеет ли смысла начать с процента разделенных чтений, отображаемых в неаннотированные регионы, где все сайты, вероятно, не аннотированы, а затем обсудить новые, ранее не аннотированные сайты в GENCODE?

В этой части текста мы использовали «сплит-чтения» вместо «предполагаемых интронов».Мы исправили текст и благодарим рецензента за это. Кроме того, 38% соответствуют предполагаемым интронам, которые отображаются на неаннотированные донорные сайты и акцепторные сайты. Сейчас мы это ясно дали понять. Наконец, мы считаем, что начало или конец фильтрации неаннотированных областей не имеет принципиального значения в способе представления этих чисел.

3) Авторы указывают, что они подбирают модель независимо для каждой комбинации донор-акцептор, которую они наблюдают.Если да, то что вызывает различия в количестве донорных (162 134), акцепторных (177 543) и переходных (156 825) связей, которые они могут моделировать? Разве им не нужен достаточный охват считыванием по всем трем параметрам, чтобы достоверно оценить скорость синтеза / расщепления на уровне соединения? Или это включает в себя некоторые случаи альтернативных пар сайтов сплайсинга?

Приносим извинения, если мы недостаточно четко объяснили это в тексте. Чтобы измерить метаболизм одинарной связи, мы индивидуально моделируем три связи (донор, акцептор и соединение) для каждого обнаруженного интрона.Мы рассматриваем каждую связь как минимум с 100 подтверждающими чтениями в наборах данных. Следовательно, нам не нужно объединять их ограничения покрытия. Теперь мы дополнительно подчеркиваем, что эти модели не связаны с предложением «мы смоделировали стационарные скорости синтеза и деградации (или эквивалентного расщепления) каждой из трех различных фосфодиэфирных связей по отдельности» в разделе «Результаты».

4) Использование моделирования для оценки надежности подгонки модели как для кинетической модели первого порядка, так и для альтернативных моделей является полезным дополнением к статье.В основном тексте следует более подробно осветить, как это подтверждает достоверность метода. Также должна быть предоставлена ​​оценка того, как метод работает и где он не работает. Например, авторы указывают, что «надежность нашего подхода… согласуется с высокой точностью процедуры аппроксимации на смоделированных данных». Однако в некоторых случаях мощность всех моделей или экспериментальных систем недостаточна. Авторы должны включить краткое обсуждение того, в чем их модель не оправдывает ожиданий (сверхвысокие скорости, соображения длины и т. Д.).) и, таким образом, более полно проинформирует читателя о биологических интерпретациях, которые можно извлечь из данных. Моделирование часто является лучшим способом продвинуть модель и проверить эти крайние случаи.

Благодарим рецензентов за предложения. Мы включили новый параграф, который объясняет результаты этих симуляций и новые симуляции, которые мы провели в ответ на этот пункт, чтобы исследовать крайние случаи. Мы добавили новый раздел в Приложение (подраздел «Пределы модели»), в котором мы исследуем пределы нашей модели.Мы смоделировали подсчеты на основе модели постоянной скорости с учетом большого диапазона логарифмически равномерно распределенных скоростей синтеза связей (10 -5 -100 л / ячейка / мин) и периодов полураспада связи (10 -3 — 7×10 — 6 мин). Основываясь на этих данных, мы исследовали типичную нижнюю границу считываний, необходимых для всех образцов, чтобы правильно смоделировать кинетику связи (Приложение — рисунок 23). Мы обнаружили, что нижнее пороговое значение в 100 считываний (после 6 -го смоделированных данных) позволяет нам оценить кинетику с типичной ошибкой ниже 100%.Пороговое значение в 100 чтений — это то, что мы применили к реальным данным. Чтобы проверить самые короткие и самые длинные периоды полураспада связи, которые наш экспериментальный подход может зафиксировать и смоделировать, мы расслоили результаты по периодам полураспада связи. Затем мы поступили аналогичным образом со скоростью синтеза связей. В результате мы обнаружили, что большая часть наших смоделированных данных находится в диапазоне, в котором средняя относительная ошибка скорости синтеза и периода полураспада ниже 100% или 30% соответственно (Приложение — рисунки 24, 25).

5) В разделе «Длина интрона ограничивает время котранскрипционного сплайсинга.«Неясно, что авторы подразумевают под« котранскрипцией ».

Как мы определили во Введении, сплайсинг является« котранскрипционным », когда он происходит на вновь синтезированной РНК, все еще прикрепленной к аппарату РНК Pol II. Это не обязательно означает, что интроны удаляются, как только акцепторный сайт транскрибируется. Тем не менее, результаты, описанные в этом разделе, не зависят от котранскрипционной природы сплайсинга. Поэтому мы изменили название подраздела, чтобы избежать недоразумений.

Авторы описывают, как период полужизни донорной связи увеличивается с увеличением длины интрона, предположительно указывая, что период полужизни донорной связи зависит от времени достижения точки ветвления и акцепторного сайта. Это означало бы, что первая стадия сплайсинга происходит вскоре после того, как акцепторный сайт расшифровывается и становится доступным.

Не обязательно. Мы интерпретируем эти наблюдения при условии, что первый этап сплайсинга происходит после (но не обязательно вскоре после) транскрибирования точки ветвления и акцепторного сайта, которые расположены близко друг к другу — обычно менее 40 нт.Мы не утверждаем, что первый шаг происходит «вскоре после того, как акцептор транскрибируется и доступен», но скорее, что расстояние между донором и точкой ветвления является ограничивающим фактором для кинетики сплайсинга только в очень длинных интронах (> 10 000 килобайт). Мы позаботились о том, чтобы это правильно поняли.

Если да, то почему период полураспада акцепторной связи такой большой? Средний период полураспада акцептора, равный 4 мин, указывает на то, что полимераза находится в среднем на расстоянии 16 килобайт к моменту, когда происходит второй этап сплайсинга.

Это могло быть правдой, поскольку 16 кб не являются чрезмерно длинными для человеческого гена (средний размер 26 кб, средний размер 66 кб). Более того, известно, что Pol II останавливается на экзонах (Mayer, et al., 2015), и такая пауза находится в диапазоне минут, и, следовательно, полимераза может не продвинуться далеко в течение 4 минут.

Предлагают ли они, чтобы первый шаг был близок по времени ко второму шагу, с задержкой между транскрипцией точки ветвления и потерей донора? Или две химические стадии разделены 4 минутами? Это кажется маловероятным, поскольку это означает, что сборка сплайсосом до образования комплекса C происходит очень быстро по сравнению с переходом от первой ко второй каталитической стадиям.

Как упоминалось в ответах на вышеупомянутые вопросы, мы оцениваем общую частоту, но не можем распутать частоту отдельных биохимических стадий, влияющих на общую частоту. За исключением очень длинных интронов, период полураспада акцепторной связи аналогичен периоду полураспада донорной связи (рис. 3В). Следовательно, наши данные фактически предполагают (в согласии с интуицией рецензента), что сборка сплайсосом до образования комплекса C происходит медленно по сравнению с переходом от первой ко второй каталитической стадии.Теперь мы предлагаем эту интерпретацию рисунка 3B в рукописи.

Если авторы думают, что потеря донора происходит ближе ко времени второго шага — намного позже появления точки ветвления — тогда определение «котранскрипции», которое включает немедленный сплайсинг после транскрипции / доступности акцепторного сайта, не соответствует действительности. кажется, держится. Все это требует более подробного объяснения.

Мы не хотим подробно обсуждать котранскрипционную природу сплайсинга, потому что это потребует другого типа данных, которые могут быть связаны с зарождающейся РНК и транскрипцией Pol II.Однако мы проверили, что мы не делаем окончательных и неподтвержденных утверждений о природе котранскрипции. В настоящее время, не имея дополнительных данных, мы не хотим выходить за рамки этого и надеемся, что рецензент поймет.

6) Неясно, как расчет выхода сплайсинга может дать значение> 1, при этом средний выход сплайсинга, указанный для мРНК, равен 1,2. Означает ли это, что измеренные уровни мРНК предшественников постоянно недооцениваются? Если он не ограничен, как описано (0-1), производительность сварки трудно оценить, поскольку кажется, что одно или несколько измеренных значений неверны.

Выход рассчитывается путем независимой оценки скорости синтеза предшественника (с использованием нерасщепленных считываний) и зрелой РНК (с использованием разделенных считываний) и взятия соотношений. Из-за ошибок оценки эти отношения могут оказаться больше 1. Мы считаем, что это приемлемо, если это не влияет на наши выводы. С помощью моделирования мы обнаружили, что совокупный охват считыванием по всем образцам, а также период полураспада могут привести к смещению оценок скорости синтеза. Однако более высокий выход мРНК по сравнению с некодирующей РНК был резюмирован при стратификации с помощью этих возможных искажающих факторов.Теперь мы включили эти анализы (Приложение — рисунки 26, 27).

Разработка акцептора сплайсинга для улучшения экспрессии генов и вирусного титра в ретровирусном векторе на основе MLV

Векторы на основе вируса лейкемии мышей (MLV) по-прежнему являются наиболее часто используемыми носителями для доставки генов, которые используются почти в 40% утвержденных клинических протоколов по всему миру. 1,2 Несмотря на их частое использование в качестве носителей для доставки генов и многообещающие терапевтические эффекты в испытании SCID-X1, 3 все еще есть области, которые необходимо улучшить, чтобы векторы на основе MLV были эффективны в фактические клинические параметры. 4,5,6,7,8,9 Во-первых, многие из этих векторов содержат последовательности, которые также присутствуют в упаковочных линиях. 6,8,10 Рекомбинация между упаковывающим геномом и вектором может привести к генерации репликационно-компетентного ретровируса (RCR). 11,12,13 Во-вторых, уровень экспрессии гена in vivo , управляемой векторами на основе MLV, по причинам, еще не полностью понятым, недостаточно высок, чтобы в большинстве случаев давать четкие терапевтические эффекты. Кроме того, вирусные титры, достигаемые векторами, хотя и улучшаются, обычно слишком низки для доставки гена в терапевтически значимое количество клеток.

Мы недавно сообщили о векторе MLV минимального размера, MT, который не содержит никаких вирусных кодирующих последовательностей. В целях дальнейшего повышения уровня экспрессии гена в этот вектор были введены часть интрона и 5′-нетранслируемых последовательностей экзона гена EF1-α человека, что, как действительно было обнаружено, значительно увеличивает уровень экспрессии гена за счет получения большое количество сплайсированных РНК. Однако вирусный титр этого ретровирусного вектора широко варьировал в зависимости от используемых упаковывающих клеточных линий. 1 Анализ РНК показал, что титр вируса был снижен из-за того, что РНК размера генома, содержащая сигнальную последовательность упаковки, была слишком эффективно сплайсирована с субгеномной РНК, что привело к снижению количества упаковываемой РНК. Это может ограничить использование этого типа вектора определенными клеточными линиями, сужая диапазон его применения в реальных промышленных условиях.

В этом эксперименте мы попытались изменить эффективность сплайсинга путем введения мутаций вокруг акцепторной последовательности сплайсинга. 14,15,16 Цель состояла в том, чтобы найти мутацию (мутации), которая могла бы снизить эффективность сплайсинга до такой степени, чтобы был получен приемлемый вирусный титр, в то время как уровень экспрессии генов все еще поддерживался на достаточно высоком уровне. После мутационного анализа была обнаружена одна такая мутация. Когда акцептор сплайсинга, содержащий эту мутацию, был введен в ретровирусный вектор, вирусный титр увеличивался до нормального уровня, при этом сохраняя высокий уровень экспрессии гена.

MINEI был первоначально получен из ретровирусного вектора MT, который не содержит никаких вирусных кодирующих последовательностей, в отличие от других векторов, доступных на момент его разработки 1 (рисунок 1).Непосредственным родительским вектором MINEI является MIN, который содержит внутренний сайт входа в рибосомы (IRES) из EMCV и бактериальный ген neo в качестве селектируемого маркера. В MINEI акцепторный сайт сплайсинга из гена EF1-α человека (нуклеотидное число от +772 до +1008), состоящий из части интрона и 5′-нетранслируемых последовательностей экзона, 1 был помещен таким образом, чтобы представляющий интерес ген должен быть выражен в основном как сплайсинговое сообщение. На фиг.1 также показан контрольный вектор DFG, полученный из MFG, содержащий акцептор сплайсинга самого MLV, присутствующего в кодирующей области pol . 17

Рисунок 1

Схематическое изображение ретровирусных векторов, используемых в этом исследовании. MT представляет собой ретровирусный вектор, не содержащий вирусных кодирующих последовательностей. 1 MIN содержит IRES из EMCV и бактериальный ген neo в качестве селектируемого маркера. MINEI включает часть интрона и акцепторную область сплайсинга из гена EF1-α человека (нуклеотидное число от +772 до +1008). 1 DFG, содержащий как IRES, так и бактериальный ген neo, является производным MFG. 16 MFG содержит вирусные кодирующие последовательности: 420 п.н. для gag , 377 для pol и 99 для env . 5,7,9 ретровирусных векторов MIN1, MIN2, MIN3 и MIN5 были получены из MINEI путем введения различных мутаций, как указано. Для создания этих мутантов интрон и экзон EF1-α, представленные в MINEI, были амплифицированы с использованием MINEI в качестве матрицы. Для создания MIN1 использовали праймеры EI5 (ACGCGTGTCGAGCTTTTGGAGTACGTCGTCTTTAGGTT) и EI3-1s (GGATCCGTTTAAACACCTGAAATGGAAGAAAAAAACTTTGAA).Амплифицированный фрагмент первоначально клонировали в pGEM T easy (Promega, WI, США). Фрагмент MluI-BamHI клонировали в сайт MluI-BamHI MIN, в результате чего получился MIN1. Для построения MIN2 использовали праймеры EI5 (ACGCGTGTCGAGCTTTTGGAGTACGTCGTCTTTAGGTT) и EI3-2s (GGATCCGTTTAAACGCCTGAAATGGAAGAAAAAACTTTGAA). Амплифицированный фрагмент первоначально клонировали в pGEM T easy. Фрагмент MluI-BamHI клонировали в сайт MluI-BamHI MIN, в результате чего получился MIN2. Для конструирования MIN3 использовали праймеры EI5m (ACGCGTGTCGAGCTTTTGGAGTACTGCGTCTTTAGGTT) и EI3-1s (GGATCCGTTTAAACACCTGAAATGGAAGAAAAAACTTTGAA).Амплифицированный фрагмент первоначально клонировали в pGEM T easy. Фрагмент MluI-BamHI клонировали в сайт MluI-BamHI MIN, в результате чего получился MIN3. Для создания MIN5 использовали праймеры EI5 (ACGCGTGTCGAGCTTTTGGAGTACGTCGTCTTTAGGTT) и EI3-21 (TTTTTGGCTTTTAGGGGTAGTTTTCACGACGGCTGAAATGGA). Амплифицированный фрагмент первоначально клонировали в pGEM T easy. Обработанный полимеразой MluI-T4 фрагмент SacII был клонирован в сайт MluI-PmeI MIN, в результате чего получился MIN5.

Когда бактериальный ген CAT использовался в качестве репортерного гена, во всех трех линиях упаковывающих клеток, используемых в этом исследовании, MINEI продуцировал в три-восемь раз более высокие уровни активности CAT, чем его родительский вектор MIN, лишенный акцептора сплайсинга (рис. 2а). ).Кроме того, воспроизводимо было обнаружено, что MINEI приводил к более высокому уровню экспрессии гена, чем контрольный вектор DFG. Однако вирусный титр MINEI варьировался в зависимости от упаковывающих клеточных линий, используемых в этом исследовании. Он был сопоставим с другими векторами в клетках Phoenix на основе 293T, но значительно ниже в клетках FLYA13 и PG13 (рис. 2b).

Рисунок 2

Сравнение различных векторов с использованием разных упаковывающих клеточных линий. Для сравнения эффективности MIN и MINEI в различных линиях упаковки соответствующие вирусы были приготовлены с использованием линий упаковки Phoenix Ampho, FlyA13 и PG13 и использованы для сравнения их титров вирусов с использованием DFG в качестве контроля.Следует отметить, что методы, использованные для измерения уровней экспрессии генов и вирусного титра для PG13, отличались от методов, используемых для Phoenix и FlyA13. Это было связано с низкой эффективностью трансфекции клеток PG13. (а) Сравнение уровня экспрессии генов. Ретровирусные векторы трансфицировали в Phoenix Ampho и линию упаковки FlyA13, соответственно, с использованием FuGene6 (Roche, Германия) в соответствии с инструкциями производителя. Уровни CAT-активности трансфицированных клеток определяли через 2 дня после трансфекции с помощью стандартной процедуры, как описано ранее Yu et al. 1 Для определения уровня экспрессии генов в упаковывающей линии PG13 клетки 293Т трансфицировали ретровирусными векторами вместе с амфотропными упаковывающими конструкциями, pVM-GP и pVM-AE, 25 и бесклеточными вирусными супернатантами из трансфицированные клетки использовали для трансдукции клеток PG13 с низким значением MOI около 0,1. После получения устойчивых к лекарственным средствам популяций определяли уровни активности CAT соответствующих линий-продуцентов. Все анализы были выполнены двумя разными исследователями, и каждый исследователь провел три независимых эксперимента.Показаны средние значения шести экспериментов, а шкала ошибок показывает стандартное отклонение. S.d. из шести экспериментов были ниже 22%. (б) Сравнение вирусных титров. Бесклеточные вирусные супернатанты от трансфицированных клеток Phoenix Ampho и FlyA13 собирали соответственно (обычно через 48 часов после трансфекции) и использовали для трансдукции клеток NIh4T3, высеянных на чашку размером 2,5 × 10 5 на 60-миллиметровую чашку накануне. Для определения вирусного титра серийно разведенные вирусные супернатанты добавляли к NIh4T3 в присутствии 8 мкг / мл полибрена.На следующий день трансдуцированные клетки переносили на чашки диаметром 100 мм и отбирали в присутствии G418 до образования видимых колоний. Титр вируса определяли путем подсчета числа устойчивых к лекарствам колоний. В случае PG13 трансдуцированные клетки высевали из расчета 5 × 10 5 клеток на 60 мм чашку и через 3 дня готовили бесклеточные вирусные супернатанты, которые использовали для трансдукции клеток HT1080 для определения вирусного титра, как описано выше. S.d. из шести экспериментов были ниже 20%, за исключением случая DFG.S.d. DFG в клетках Phoenix составляли до 30%.

Мы ранее сообщали, что низкий вирусный титр MINEI в этих клеточных линиях является результатом высокоэффективного сплайсинга геномного транскрипта из-за присутствия гетерологичного акцептора сплайсинга. 1 На основании этого открытия была выдвинута гипотеза, что акцепторный сайт сплайсинга может быть сконструирован таким образом, чтобы его функция ослаблялась до такой степени, что титр вируса повышался до уровня контрольных векторов, при сохранении более высокого уровня экспрессии гена.Универсально консервативными элементами последовательности сайтов сплайсинга являются последовательность (5 ‘) GU, (3’) AG, полипиримидиновый тракт и сайт ответвления у позвоночных. 14,18,19,20,21 Нуклеотидные последовательности, соседствующие с этими консервативными последовательностями, по-видимому, имеют определенный паттерн, обнаруживаемый с частотами выше, чем ожидалось из случайного распределения. 14,18 Поскольку изменения в консервативных элементах последовательности резко изменяют паттерн процессинга РНК в целом, мы мутировали соседние последовательности, ожидая получения вышеуказанных характеристик. 22,23,24 Мутации были введены вокруг акцепторной области сплайсинга, как показано на рисунке 1, и протестированы на их влияние на титр вируса, уровень экспрессии генов и характер сплайсинга. Для простоты анализа бактериальная последовательность CAT изначально использовалась в качестве репортерного гена, который коэкспрессируется с селектируемым маркером neo в качестве бицистронного сообщения.

Клетки 293T трансфицировали мутантными конструкциями (MIN1, MIN2, MIN3 и MIN5), MINEI и двумя контрольными векторами (MIN и DFG) вместе с амфотропными упаковывающими конструкциями, pVM-GP и pVM-AE. 25 Бесклеточные вирусные супернатанты использовали для трансдукции клеток PG13 с MOI <0,1 с последующим отбором G418. Были получены популяции, устойчивые к лекарственным средствам, и определены уровни активности CAT. Поскольку считалось, что трансдуцированные клетки содержат в среднем одну копию интегрированного вектора, уровень активности CAT будет отражать относительный уровень экспрессии гена из конкретной векторной конструкции в трансдуцированных клетках. В этом анализе целенаправленно анализировалась популяция клеток, а не субклон, поскольку она отражала бы общие характеристики данного ретровирусного вектора.Через 3 дня после посева 5 × 10 5 трансдуцированных клеток PG13 на чашку диаметром 60 мм отбирали культуральные супернатанты и использовали их для определения титра вируса в клетках HT1080.

Как показано, MINEI и все мутантные конструкции давали примерно в восемь раз более высокий уровень экспрессии генов в упаковывающей линии PG13, чем MIN, и в два-три раза выше, чем у DFG (рис. 3a). (Обратите внимание, что для удобного сравнения между векторами уровни активности CAT от различных векторов были стандартизированы с помощью MIN.) Интересно, что вирусный титр от MIN5 был сопоставим с титром от его родительской конструкции MIN (рис. 3b), тогда как другие мутантные конструкции (MIN1, MIN2 и MIN3) давали низкие вирусные титры в клетках PG13, аналогичные результатам, полученным от MINEI ( Рисунок 3б). Эти результаты свидетельствуют о том, что MIN5 не только поддерживает высокий уровень экспрессии гена, но также дает приемлемый вирусный титр.

Рисунок 3

Влияние различных мутаций, введенных в MINEI, на титр вируса и уровень экспрессии генов в линиях упаковывающих клеток PG13.Как описано в тексте, мутантные векторы и контрольные векторы, полученные из MINEI, трансфицировали в клетки 293T вместе с амфотропными упаковывающими конструкциями VM-GP и VM-AE. Через 2 дня готовили бесклеточные вирусные супернатанты, которые использовали для трансдукции упаковывающих линий PG13 с MOI <0,1 с последующим отбором G418. После получения устойчивой к лекарственным средствам популяции измеряли уровни активности CAT (а) и титр вируса (b), как описано на фиг. 2. Средние значения шести экспериментов представлены с помощью s.d. значение <16% (а) и <10% (б) соответственно. Различия в титрах между векторами MINEI и MIN5 очень значительны (P = 0,0102).

Затем мы проанализировали качество и количество вирусных РНК, продуцируемых различными векторами в клетках PG13. Полные РНК были получены и проанализированы с помощью Нозерн-блот-гибридизации с использованием последовательности CAT в качестве зонда (фиг. 4). MIN продуцировал только геномный транскрипт, потому что он не имел акцепторной последовательности сплайсинга (рисунок 4, дорожка 1), в то время как MINEI и мутантные конструкции генерировали два вида РНК, геномный транскрипт и сплайсированный субгеномный транскрипт (рисунок 4, дорожки 2-6). .Как и ожидалось, MINEI продуцировал большое количество сплайсированных РНК по сравнению с геномной РНК (рис. 4, дорожка 5). Было ясно, что большинство геномных РНК, созданных в этом векторе, были сплайсированы, что привело к высокому уровню активности CAT, но низкому титру вируса. Три мутантные конструкции (MIN1, MIN2 и MIN3) показали аналогичную картину в соотношении геномных и субгеномных РНК (рис. 4, дорожка 2–4), в то время как MIN5 продуцировал значительно более высокий уровень геномного транскрипта, чем MINEI (рис. 4, дорожка 6). ). Эти результаты свидетельствуют о том, что мутации, введенные в MIN5, изменяют эффективность сплайсинга, увеличивая титр вируса, сохраняя при этом высокий уровень экспрессии генов.

Фигура 4

РНК-блот-анализ упаковывающих клеток PG13, трансдуцированных MIN, MINEI и вновь сконструированными мутантными векторами. Тотальные клеточные РНК получали с использованием метода тиоцианата гуанидина и хлорида цезия. Суммарную РНК (20 мкг) подвергали электрофорезу в 1% формальдегид-агарозном геле, наносили на нитроцеллюлозную мембрану (Hybond-C; Amersham, RPN303W, США) и гибридизовали с CAT-зондом, меченным 32 P (BamHI CAT фрагмент MIN-CAT). Зонд клеточного β-актина использовали в качестве контроля загрузки.G — геномный транскрипт; SG, субгеномная РНК; А, β-актиновая РНК.

Чтобы проверить, сохраняет ли MIN5 свои характеристики в других клеточных линиях, мы повторили аналогичный эксперимент на клетках 293T. MINEI, четыре мутантных конструкции и два контрольных вектора (MIN и DFG) трансфицировали в клетки 293T вместе с амфотропными упаковывающими конструкциями pVM-GP и pVM-AE. Через 2 дня измеряли уровни активности CAT в трансфицированных клетках. Это будет представлять уровень экспрессии гена, продуцируемой данной ретровирусной конструкцией в клетках 293T.Для определения вирусного титра использовали культуральные супернатанты для трансдукции клеток NIh4T3. При использовании клеток 293T наблюдалась разница в уровне экспрессии генов между MINEI и мутантными конструкциями, в отличие от клеток PG13. Уровень активности CAT от MIN5 был в два-три раза ниже, чем от MINEI, но все же выше, чем от MIN и DFG (рис. 5a). Вирусный титр MIN5 был сопоставим с титром MIN и DFG (рис. 5b). Эти результаты предполагают, что MIN5 может быть полезен, даже если клетки 293T использовались в качестве упаковывающей клеточной линии.

Рисунок 5

Сравнение мутантных векторов в клетках 293T. Полученные из MINEI мутантные векторы и контрольные векторы трансфицировали в клетки 293T вместе с амфотропными упаковывающими конструкциями. Уровень активности CAT определяли через 2 дня после трансфекции (а). В то же время был приготовлен культуральный супернатант, который использовали для трансдукции клеток NIh4T3 для определения вирусного титра (b). S.d. значения трех экспериментов были ниже 20% по уровню экспрессии генов и ниже 34% в случае вирусного титра.

Чтобы проверить, ограничено ли наше наблюдение бактериальным геном CAT, мы использовали ген, кодирующий белок антагониста рецептора интерлейкина 1 человека (IRAP) или глюкоцереброзидазу (GC) как в клетках PG13, так и в клетках 293T. Эти две кДНК были клонированы в MIN5, а также в три других контрольных вектора, DFG, MIN и MINEI, которые затем сравнивали по их вирусному титру и уровню экспрессии генов. Как показано в таблице 1, MINEI продуцировал самый высокий уровень белка IRAP, но самый низкий вирусный титр как в клетках PG13, так и в клетках 293T.Однако при использовании MIN5 вирусный титр увеличивался в девять и четыре раза в клетках PG13 и 293T соответственно. MIN5 также может продуцировать высокий уровень белка IRAP в обеих клеточных линиях, что согласуется с приведенными выше результатами (Таблица 1). Производительность MIN5 была более заметной при использовании гена GC. MIN5 продуцировал самый высокий уровень активности GC и самый высокий титр вируса как в клетках PG13, так и в клетках 293T.

Таблица 1 Характеристики MIN5, экспрессирующие человеческие белки

Затем мы протестировали MIN5 на двух разных типах клеток, которые коррелировали с генной терапией человека, линией эритролейкемии человека K562 и первичными фибробластами кожи, выделенными от пациента с болезнью Гоше.Клетки трансдуцировали 0,5 мл вирусного супернатанта линий продуцентов PG13 IRAP и GC, соответственно. Через 2 дня в соответствующих трансдуцированных клетках измеряли уровни белка IRAP и активность ГХ. Уровень экспрессии гена в этом анализе будет представлять титр вируса, а также уровень экспрессии гена, управляемый соответствующим вектором. Как ясно показано в таблице 2, MIN5 приводил к наивысшему уровню экспрессии гена в клетках K562, а также в первичных фибробластах кожи. Эти данные продемонстрировали, что MIN5 может управлять высоким уровнем экспрессии гена без ущерба для вирусного титра, и что наше наблюдение не ограничивалось конкретным репортерным геном или типом клеток.

Таблица 2 Характеристики MIN5 в трансдуцированных клетках-мишенях

Анализировали содержание РНК, продуцируемых ретровирусным вектором, экспрессирующим IRAP, в клетках K562. Клетки K562 трансдуцировали при MOI <0,1 с последующим отбором G418. Тотальные РНК получали из популяций, устойчивых к G418, и анализировали с помощью Нозерн-блот-гибридизации с использованием последовательности neo в качестве зонда (фиг. 6). DFG продуцировал два вида РНК, поскольку он содержал акцепторную последовательность ретровирусного сплайсинга, расположенную в гене pol (фиг. 6, дорожка 1).Большая часть РНК, полученной из вектора DFG, оказалась геномным транскриптом. Неожиданно вектор MIN, который не содержит акцепторного сайта сплайсинга, произвел большое количество сплайсированных РНК (рис. 6, дорожка 2). Оказалось, что последовательность кДНК IRAP содержит скрытый сайт сплайсинга, присутствующий в кодирующей области, который использовался высокоэффективно, снижая как титр вируса, так и уровень экспрессии гена (данные не показаны). В соответствии с предыдущими результатами, MINEI продуцировал большое количество субгеномной РНК ожидаемого размера, но очень низкий уровень геномного транскрипта.В MIN5 уровень упаковываемой РНК был заметно увеличен. Эти результаты предполагают, что MIN5, экспрессирующий IRAP, ведет себя, как ожидалось, в клетках K562, а также что присутствие гетерологичного акцептора сплайсинга может подавлять использование скрытого сайта сплайсинга, присутствующего в кодирующей области.

Фигура 6

РНК-блот-анализ клеток K562, трансдуцированных ретровирусными векторами DFG, MIN, MINEI и MIN5. Условия эксперимента были идентичны тем, которые описаны на фиг. 4, за исключением того, что РНК (20 мкг) была гибридизирована с зондом Neo, меченным 32 P, выделенным из MIN-CAT.G — геномный транскрипт; SG, субгеномная РНК; cS, криптическая сплайсированная РНК; А, β-актиновая РНК.

Известно, что сплайсинг необходим для быстрого и эффективного экспорта мРНК, а введение интронов может повысить уровень экспрессии генов. 26,27,28,29 Мы и другие исследовали возможность применения этой концепции в контексте ретровирусных векторов.

Например, MFG, который оказался очень эффективным ретровирусным вектором с точки зрения вирусного титра и уровня экспрессии гена, содержит 400 п.н. 3′-конца кодирующей области pol .Поскольку эта область включает сайт ветвления ретровируса и акцептор сплайсинга для сообщения env , часть вирусной РНК сплайсируется с субгеномной РНК, что приводит к усиленной экспрессии представляющих интерес трансгенов. 30 Однако одной из основных проблем при использовании MFG является возможность генерации RCR, поскольку он содержит биты вирусных кодирующих последовательностей, включая gag и env , а также pol , что увеличивает возможность гомологичной рекомбинации между вектор и геном упаковки. 25

Hildinger et al 31 также сообщили о ретровирусных векторах, содержащих акцепторы сплайсинга. В этом случае акцепторную последовательность сплайсинга длиной 48 п.н. из мышиного ретровируса SFFVp вводили в их векторы, производные от SF, что приводило к повышенной экспрессии генов. Однако следует отметить, что 26 п.н. из 48 п.н. были идентичны кодирующей области pol MLV, что снова может способствовать возможной гомологичной рекомбинации. Они предположили, что эта проблема может быть преодолена путем устранения остаточной гомологии путем колебания последовательности или путем создания неретровирусного акцептора сплайсинга.

В нашем предыдущем эксперименте мы продемонстрировали, что введение гетерологичного клеточного или вирусного акцепторного сайта сплайсинга в ретровирусный вектор значительно увеличивает уровень экспрессии гена, но снижает титр вируса. 1 В этой серии экспериментов мы ввели мутации вокруг акцепторной области сплайсинга, чтобы улучшить вирусный титр вектора MINEI, и наши данные продемонстрировали, что эффективность сплайсинга мутанта MIN5 действительно изменилась. MIN5 вызывал немного более низкий уровень экспрессии генов, чем MINEI, потому что его эффективность сплайсинга была снижена, но все же приводил к более высокому уровню экспрессии генов, чем MIN или DFG.По той же причине вирусный титр MIN5 увеличился в 5–10 раз, чем титр MINEI, и стал сопоставим с титром DFG или MIN в клетках PG13. Более того, когда использовался ген GC, MIN5 приводил к наивысшему уровню экспрессии гена и вирусному титру, чем любые другие ретровирусные векторы, использованные в этом исследовании.

Эффективность сплайсинга и эффект мутации вокруг сайта сплайсинга, по-видимому, зависят от различных факторов в контексте ретровирусных векторов. Во-первых, эффективность сплайсинга одного и того же акцептора сплайсинга может различаться в разных клеточных линиях.MIN1, MIN2 и MIN3 все показали высокие уровни экспрессии генов, но низкий титр в клетках PG13. Однако в клетках 293T эти мутанты давали низкие титры и пониженную экспрессию. Вероятно, это связано с тем, что количество различных факторов трансакции, участвующих в процессе сплайсинга, варьируется в зависимости от типов клеток. Среди мутантов пока не ясно, почему MIN3 дает самую низкую экспрессию гена и самый низкий вирусный титр в клетках 293T. Одна возможность состоит в том, что мутация, введенная в интронную последовательность в MIN3, может влиять на сборку и / или разборку сплайсосомы.Во-вторых, природа нуклеотидной последовательности встроенного гена, по-видимому, также влияет на эффективность сплайсинга и, таким образом, на характеристики ретровирусного вектора. Относительные уровни экспрессии генов и относительный титр вируса значительно различались между CAT, IRAP и GC для данного вектора и данной клеточной линии. Эти данные означают, что нужно быть очень осторожным при выборе оптимального ретровирусного вектора для реальной генной терапии.

Титр вируса и уровень экспрессии гена в трансдуцированных клетках — два ключевых фактора, влияющих на успех испытаний генной терапии.MIN5, описанный в этом отчете, обладает характеристиками как эффективный вектор для средства доставки генов, поскольку он обеспечивает более высокий уровень экспрессии генов, чем другие доступные в настоящее время векторы в различных клеточных линиях, при этом обеспечивая сопоставимый вирусный титр. Кроме того, он не содержит вирусной кодирующей последовательности, что сводит к минимуму продукцию ретровируса, способного к репликации. Ретровирусный вектор MIN5 может быть использован в качестве средства доставки генов в генной терапии.

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Биологическое значение и взаимодействие акцепторов сплайсинга регулирующих генов ВИЧ-1

https: // doi.org / 10.1006 / viro.1994.1342Права и содержание

Abstract

Изучена репликация мутантов ВИЧ-1, содержащих измененные акцепторные последовательности сплайсинга. Акцепторные сайты сплайсинга 5 ‘основных кодонов tat и rev AUG были изменены для исключения специфически сплайсированных видов из вирусного репертуара мРНК. Все мутанты сайта сплайсинга были аттенуированы или полностью дефектны. Мутация акцептора сплайсинга tat (экзон 4) вызвала потерю видов мРНК, содержащих экзон 4, и привела к ослабленному, но конкурирующему с репликацией фенотипу.Мутация акцепторных сайтов сплайсинга rev привела к вирусным геномам, которые не смогли распространять in vitro . Мутация более 5 ‘из двух основных акцепторов rev (экзон 4A) вызвала потерю видов мРНК, содержащих экзон 4A, вместе с компенсаторным увеличением использования более 3’из акцепторов rev (экзон 4B). Мутация акцептора сплайсинга для экзона 4B вызвала неожиданную потерю мРНК, содержащих как экзон 4A, так и 4B. В дополнение к этим эффектам на акцепторы сплайсинга rev , мутации в сайтах 4A и 4B также привели к уменьшению использования сайта сплайсинга tat (экзон 4), расположенного на 175 нуклеотидов выше.Эти эффекты на использование акцепторного сайта сплайсинга tat могут объяснить потребность в tat для эффективного дополнения этих мутантов. Мутант 4A был дополнен tat , но не rev. Мутант 4B был дополнен rev , но для максимальной комплементации потребовались как tat , так и rev . Эти данные свидетельствуют о кооперативности этих сайтов сплайсинга, необходимой для эффективной репликации вируса. Они также указали, что, хотя репликация вируса сохранялась на низких уровнях в отсутствие сплайсинга с известным сайтом 5 ‘ tat AUG, неспособность сплайсироваться по крайней мере с одним из двух основных сайтов 5′ rev AUG приводила к в недостаточной активности rev для репликационной способности.

Рекомендуемые статьиЦитирующие статьи (0)

Полный текст

Copyright © 1994 Academic Press. Все права защищены.

Рекомендуемые статьи

Цитирующие статьи

Плагин акцептора донора водородной связи

Это руководство содержит пошаговые инструкции по использованию подключаемого модуля донора / акцептора H Bond:

Плагин донора / акцептора водородной связи вычисляет донорные и акцепторные свойства водородных связей атомов в молекуле.Атомные данные и общая множественность доноров и акцепторов водородной связи отображаются для соответствующих атомов входящей молекулы (или ее микроразновидностей при заданном pH).

Плагин также может рассчитывать взвешенные средние множественности доноров и акцепторов водородных связей по набору микровидов входной молекулы при заданном pH. Затем он вычисляет распределение их появления в диапазоне pH и отображает его в виде диаграммы.

В следующем окне показан результат такого расчета.

Рис. 1 H Окно результатов донора / акцептора связи

Вот определение количества доноров / акцепторов и сайтов, которые используются в плагине:

  • Количество доноров = сумма атомов в молекуле, обладающих свойством донора водорода.

  • Донорные узлы = сумма атомов H, связанных с донорными атомами.

  • Число акцепторов = сумма акцепторных атомов. У акцепторного атома всегда есть неподеленная электронная пара / неподеленная электронная пара, которая способна устанавливать Н-связь.

  • Акцепторные центры = сумма неподеленных пар на акцепторных атомах.

Следующая молекула имеет доноров из 2 и 4 донорных сайтов , потому что каждый донорный атом N может обеспечивать 2 донорных атома H. Он также имеет количество акцепторов из 6 и 6 акцепторных сайтов , потому что каждый акцепторный атом N может принимать 1 донорный атом.

Рис. 2 Пример молекулы, показывающий различные присвоенные характеристики HBDA

В окне H Bond Donor / Acceptor Options можно задать различные параметры расчета:

  • Десятичные разряды: установка количества десятичных знаков, с которыми выдается значение результата.

  • Тип: определяет тип вычислений (донор или акцептор).

  • Исключить атомы серы из акцепторов : если задано, атомы серы в акцепторах исключены.

  • Исключить галогены из акцепторов: если задано, атомы галогенов в акцепторах исключены.

  • Показать данные о микровидах по pH: отображается диаграмма зависимости количества донорных или акцепторных сайтов от pH.

  • Microspecies: задает размеры диаграммы pH с параметрами нижнего предела pH, верхнего предела pH и шага pH . Значения по умолчанию — 0, 14 и 0,5 соответственно. (см. пример ниже)

  • Показать основные микровиды: отображается структура основной формы при заданном pH.

Рис. 3 Варианты донора / акцептора H-связи

Картирование доноров и акцепторов сплайсинга ВИЧ-189.6. Последовательность PacBio® …

Воспалительное заболевание кишечника, вызванное чрезмерной заменой соевого белка на белок рыбной муки (FM), является обычным явлением. Жемчужный морской окунь, Epinephelus fuscoguttatus ♀ × Epinephelus lanceolatus ♂, морская рыба с важными экономическими и пищевыми ценностями, сталкивается с аналогичной проблемой. Насколько нам известно, сообщений о полноразмерном транскриптоме жемчужного окуня нет. В настоящем исследовании было приготовлено семь изоазотных и изолипидных (10% липидов) рационов, которые скармливались рыбам в течение 10 недель.Объем воды в каждой бочке составлял около 1 м³ при естественном освещении и температуре. Результаты показали, что 40% диетических соевых белков значительно отрицательно повлияли на показатели роста горечавки-окуня. По сравнению с контролем FM, содержание иммуноглобулина М и ферментативная активность глутатионредуктазы, глутатионпероксидазы и общей супероксиддисмутазы в кишечнике значительно увеличились; значительно снизилось содержание малонового диальдегида в кишечнике; и активность ферментов аланинтрансаминазы и аспартаттрансаминазы в печени значительно увеличилась.Библиотека, состоящая из семи различных обработанных тканей дистального отдела кишечника, включая контрольную группу FM, 20% заменитель соевого шрота для FM (SBM20), SBM40, 20% концентрат соевого белка (SPC20), SPC40, 20% заменитель ферментированного соевого шрота для FM ( FSBM20) и FSBM40 были сконструированы и секвенированы с использованием одномолекулярных соединений PacBio в реальном времени (SMRT) и технологии RNA-Seq. В целом, это исследование получило 420 006 полноразмерных нехимерных (FLNC) прочтений. После исправления ошибок, кластеризации последовательностей и избыточности было получено 82 351 транскрипт с высоким качеством.Кроме того, всего 77 815 транскриптов были аннотированы в семи базах данных (неизбыточные последовательности белков, неизбыточные нуклеотидные последовательности, семейство белков, кластеры ортологичных групп белков, онтология генов, Swiss-Prot и ортология KEGG). Также было идентифицировано 49 093 длинных некодирующих РНК (днРНК) и 141 702 простых повтора последовательности. Основываясь на секвенировании полноразмерных транскриптомов, настоящее исследование показало, что сигнальный путь Toll-подобного рецептора / ядерного фактора каппа-B играет важную роль в развитии энтерита, индуцированного SBM и FSBM.Энтерит, вызванный SPC, в основном сопровождается общим дисбалансом сигнальных путей, связанных с усвоением пищи, который влияет только на небольшую часть сигнальных путей, связанных с иммунитетом.

Добавить комментарий

Ваш адрес email не будет опубликован.